AptaMat is a simple script which aims to measure differences between DNA or RNA secondary structures.

Related tags

Data Analysisbioinformaticscomparisondnarnasecondary-structurenucleic-acids
Overview

AptaMAT

Purpose

AptaMat is a simple script which aims to measure differences between DNA or RNA secondary structures. The method is based on the comparison of the matrices representing the two secondary structures to analyze, assimilable to dotplots. The dot-bracket notation of the structure is converted in a half binary matrix showing width equal to structure's length. Each matrix case (i,j) is filled with '1' if the nucleotide in position i is paired with the nucleotide in position j, with '0' otherwise.

The differences between matrices is calculated by applying Manhattan distance on each point in the template matrix against all the points from the compared matrix. This calculation is repeated between compared matrix and template matrix to handle all the differences. Both calculation are then sum up and divided by the sum of all the points in both matrices.

Dependencies

AptaMat have been written in Python 3.8+

Two Python modules are needed :

These can be installed by typing in the command prompt either :

./setup

or

pip install numpy
pip install scipy

Use of Anaconda is highly recommended.

Usage

AptaMat is a flexible Python script which can take several arguments:

  • structures followed by secondary structures written in dotbracket format
  • files followed by path to formatted files containing one, or several secondary structures in dotbracket format

Both structures and files are independent functions in the script and cannot be called at the same time.

usage: AptaMAT.py [-h] [-structures STRUCTURES [STRUCTURES ...]] [-files FILES [FILES ...]]

The structures argument must be a string formatted secondary structures. The first input structure is the template structure for the comparison. The following input are the compared structures. There are no input limitations. Quotes are necessary.

usage: AptaMat.py structures [-h] "struct_1" "struct_2" ["struct_n" ...]

The files argument must be a formatted file. Multiple files can be parsed. The first structure encountered during the parsing is used as the template structure. The others are the compared structures.

usage: AptaMat.py -files [-h] struct_file_1 [struct_file_n ...]

The input must be a text file, containing at least secondary structures, and accept additional information such as Title, Sequence or Structure index. If several files are provided, the function parses the files one by one and always takes the first structure encountered as the template structure. Files must be formatted as follows:

>5HRU
TCGATTGGATTGTGCCGGAAGTGCTGGCTCGA
--Template--
((((.........(((((.....)))))))))
--Compared--
.........(((.(((((.....))))).)))

Examples

structures function

First introducing a simple example with 2 structures:

AptaMat : 0.08 "> 
$ AptaMat.py -structures "(((...)))" "((.....))"
 (((...)))
 ((.....))
> AptaMat : 0.08

Then, it is possible to input several structures:

AptaMat : 0.08 (((...))) .(.....). > AptaMat : 0.2 (((...))) (.......) > AptaMat : 0.3 "> 
$ AptaMat.py -structures "(((...)))" "((.....))" ".(.....)." "(.......)"
 (((...)))
 ((.....))
> AptaMat : 0.08

 (((...)))
 .(.....).
> AptaMat : 0.2

 (((...)))
 (.......)
> AptaMat : 0.3

files function

Taking the above file example:

$ AptaMat.py -files example.fa
5HRU
Template - Compared
 ((((.........(((((.....)))))))))
 .........(((.(((((.....))))).)))
> AptaMat : 0.1134453781512605

Note

Compared structures need to have the same length as the Template structure.

For the moment, no features have been included to check whether the base pair is able to exist or not, according to literature. You must be careful about the sequence input and the base pairing associate.

The script accepts the extended dotbracket notation useful to compare pseudoknots or Tetrad. However, the resulting distance might not be accurate.

You might also like...
The Spark Challenge Student Check-In/Out Tracking Script

The Spark Challenge Student Check-In/Out Tracking Script This Python Script uses the Student ID Database to match the entries with the ID Card Swipe a

null 1 Dec 9, 2021
Python script to automate the plotting and analysis of percentage depth dose and dose profile simulations in TOPAS.

topas-create-graphs A script to automatically plot the results of a topas simulation Works for percentage depth dose (pdd) and dose profiles (dp). Dep

Sebastian Schäfer 10 Dec 8, 2022
Flenser is a simple, minimal, automated exploratory data analysis tool.

Flenser Have you ever been handed a dataset you've never seen before? Flenser is a simple, minimal, automated exploratory data analysis tool. It runs

John McCambridge 79 Sep 20, 2022
Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video.
Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video.

Datashredder is a simple data corruption engine written in python. You can corrupt anything text, images and video. You can chose the cha

null 2 Jul 22, 2022
WithPipe is a simple utility for functional piping in Python.

A utility for functional piping in Python that allows you to access any function in any scope as a partial.

Michael Milton 1 Oct 26, 2021
Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment
Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment

Data Scientist in Simple Stock Analysis of PT Bukalapak.com Tbk for Long Term Investment Brief explanation of PT Bukalapak.com Tbk Bukalapak was found

Najibulloh Asror 2 Feb 10, 2022
My first Python project is a simple Mad Libs program.
My first Python project is a simple Mad Libs program.

Python CLI Mad Libs Game My first Python project is a simple Mad Libs program. Mad Libs is a phrasal template word game created by Leonard Stern and R

Carson Johnson 1 Dec 10, 2021
simple way to build the declarative and destributed data pipelines with python

unipipeline simple way to build the declarative and distributed data pipelines. Why you should use it Declarative strict config Scaffolding Fully type

aliaksandr-master 0 Jan 26, 2022
Generates a simple report about the current Covid-19 cases and deaths in Malaysia

Generates a simple report about the current Covid-19 cases and deaths in Malaysia. Results are delay one day, data provided by the Ministry of Health Malaysia Covid-19 public data.

Yap Khai Chuen 7 Dec 15, 2022
Comments
  • Allow comparison with not folded secondary structure

    Allow comparison with not folded secondary structure

    User may want to perform quantitative analysis and attribute distance to non folded oligonucleotides against folded anyway for example in pipeline. Different solution can be considered:

    • Give a default distance value to unfolded vs folded structure (worst solution)
    • Distance must be equal to the maximum number of base pair observable : len(structrure)//2. Several issues could arise from this:
      • How to manage with enhancement #7 ? Take the largest ? Shortest ?
      • It would give abnormally high distance value and will remains constistent even though different structure folding are compared to the same unfolded structure. Considering our main advantage over others algorithm, failed to rank at this point is not good.
    • Assign Manhattan Distance for each point in matrix ( the one showing folding) the farthest theoretical + 1 in the structure. This may give a large distance between the two structures no matter the size and the + 1 prevent an equality one distance with an actually folded structure showing the same coordinate than the farthest theoretical point. Moreover, we can obtain different score when comparing different folding to the same unfolded structure.
    enhancement 
    opened by GitHuBinet 0
  • Different length support and optimal alignment

    Different length support and optimal alignment

    Allow different structure length alignment. This would surely needs an optimal structure alignment to make AptaMat distance the lowest for a shared motif. Maybe we should consider the missing bases in the score calculation.

    enhancement 
    opened by GitHuBinet 0
  • Is the algorithm time consuming ?

    Is the algorithm time consuming ?

    Considering the expected structure size (less than 100n) the calculation run quite fast. However, theoretically the calculation can takes time when the structure is larger with complexity around log(n^2). Possible improvement can be considered as this time complexity is linked with the double browsing of dotbracket input

    • [ ] Think about the possibility of improving this bracket search.
    • [ ] Study the .ct notation for ssNA secondary structure (see in ".ct notation" enhancement)
    • [x] #6
    • [ ] Test the algorithm with this new feature
    question 
    opened by GEC-git 0
  • G-quadruplex/pseudoknot comprehension

    G-quadruplex/pseudoknot comprehension

    Add features with G-quadruplex and pseudoknot comprehension. This kind of secondary structures requires extended dotbracket notation. https://www.tbi.univie.ac.at/RNA/ViennaRNA/doc/html/rna_structure_notations.html

    The '([{<' & string.ascii_uppercase is already included but some doubt remain about the comparison accuracy because no test have been done on this kind of secondary structure

    • [ ] Perform some try on Q-quadruplex & pseudoknots and conclude about comparison reliability. /!\ The complexity comes from the G-quadruplex structures. The tetrad can form base pair in many different way and some secondary structure notation can be similar. Here is an exemple of case with the same interacting Guanine GGTTGGTGTGGTTGG ([..[)...(]..]) ((..)(...)(..))
    • [x] #5
    enhancement invalid 
    opened by GEC-git 0
Releases(v0.9-pre-release)

  • v0.9-pre-release(Oct 28, 2022)

    Pre-release content

    https://github.com/GEC-git/AptaMat

    • Create LICENSE by @GEC-git in https://github.com/GEC-git/AptaMat/pull/2
    • main script AptaMat.py
    • README.MD edited and published
    • Beta AptaMat logo edited and published

    Contributors

    • @GEC-git contributed in https://github.com/GEC-git/AptaMat
    • @GitHuBinet contributed in https://github.com/GEC-git/AptaMat

    Full Changelog: https://github.com/GEC-git/AptaMat/commits/v0.9-pre-release

    Source code(tar.gz)
    Source code(zip)
Owner
GEC UTC
We are the "Genie Enzymatique et Cellulaire" CNRS UMR 7025 research unit.
GEC UTC
GitHub Repository
Repository created with LinkedIn profile analysis project done

EN/en Repository created with LinkedIn profile analysis project done. The datase

Mayara Canaver 4 Aug 06, 2022
Conduits - A Declarative Pipelining Tool For Pandas

Conduits - A Declarative Pipelining Tool For Pandas Traditional tools for declaring pipelines in Python suck. They are mostly imperative, and can some

Kale Miller 7 Nov 21, 2021
MS in Data Science capstone project. Studying attacks on autonomous vehicles.

Surveying Attack Models for CAVs Guide to Installing CARLA and Collecting Data Our project focuses on surveying attack models for Connveced Autonomous

Isabela Caetano 1 Dec 09, 2021
A program that uses an API and a AI model to get info of sotcks

Stock-Market-AI-Analysis I dont mind anyone using this code but please give me credit A program that uses an API and a AI model to get info of stocks

1 Dec 17, 2021
PLStream: A Framework for Fast Polarity Labelling of Massive Data Streams

PLStream: A Framework for Fast Polarity Labelling of Massive Data Streams Motivation When dataset freshness is critical, the annotating of high speed

4 Aug 02, 2022
CINECA molecular dynamics tutorial set

High Performance Molecular Dynamics Logging into CINECA's computer systems To logon to the M100 system use the following command from an SSH client ss

J. W. Dell 0 Mar 13, 2022
A crude Hy handle on Pandas library

Quickstart Hyenas is a curde Hy handle written on top of Pandas API to allow for more elegant access to data-scientist's powerhouse that is Pandas. In

Peter Výboch 4 Sep 05, 2022
Tools for working with MARC data in Catalogue Bridge.

catbridge_tools Tools for working with MARC data in Catalogue Bridge. Borrows heavily from PyMarc

1 Nov 11, 2021
Python implementation of Principal Component Analysis

Principal Component Analysis Principal Component Analysis (PCA) is a dimension-reduction algorithm. The idea is to use the singular value decompositio

Ignacio Darago 1 Nov 06, 2021
A utility for functional piping in Python that allows you to access any function in any scope as a partial.

WithPartial Introduction WithPartial is a simple utility for functional piping in Python. The package exposes a context manager (used with with) calle

Michael Milton 1 Oct 26, 2021
A python package which can be pip installed to perform statistics and visualize binomial and gaussian distributions of the dataset

GBiStat package A python package to assist programmers with data analysis. This package could be used to plot : Binomial Distribution of the dataset p

Rishikesh S 4 Oct 17, 2022
Data Science Environment Setup in single line

datascienv is package that helps your to setup your environment in single line of code with all dependency and it is also include pyforest that provide single line of import all required ml libraries

Ashish Patel 55 Dec 16, 2022
Implementation in Python of the reliability measures such as Omega.

OmegaPy Summary Simple implementation in Python of the reliability measures: Omega Total, Omega Hierarchical and Omega Hierarchical Total. Name Link O

Rafael Valero Fernández 2 Apr 27, 2022
Using Python to derive insights on particular Pokemon, Types, Generations, and Stats

Pokémon Analysis Andreas Nikolaidis February 2022 Introduction Exploratory Analysis Correlations & Descriptive Statistics Principal Component Analysis

Andreas 1 Feb 18, 2022
Python utility to extract differences between two pandas dataframes.

Python utility to extract differences between two pandas dataframes.

Jaime Valero 8 Jan 07, 2023
The lastest all in one bombing tool coded in python uses tbomb api

BaapG-Attack is a python3 based script which is officially made for linux based distro . It is inbuit mass bomber with sms, mail, calls and many more bombing

59 Dec 25, 2022
Created covid data pipeline using PySpark and MySQL that collected data stream from API and do some processing and store it into MYSQL database.

Created covid data pipeline using PySpark and MySQL that collected data stream from API and do some processing and store it into MYSQL database.

2 Nov 20, 2021
First and foremost, we want dbt documentation to retain a DRY principle. Every time we repeat ourselves, we waste our time. Second, we want to understand column level lineage and automate impact analysis.

dbt-osmosis First and foremost, we want dbt documentation to retain a DRY principle. Every time we repeat ourselves, we waste our time. Second, we wan

Alexander Butler 150 Jan 06, 2023
BigDL - Evaluate the performance of BigDL (Distributed Deep Learning on Apache Spark) in big data analysis problems

Evaluate the performance of BigDL (Distributed Deep Learning on Apache Spark) in big data analysis problems.

Vo Cong Thanh 1 Jan 06, 2022
Analysis scripts for QG equations

qg-edgeofchaos Analysis scripts for QG equations FIle/Folder Structure eigensolvers.py - Spectral and finite-difference solvers for Rossby wave eigenf

Norman Cao 2 Sep 27, 2022