produces PCA on genotypes from fasta files (popPhyl's ID format)

Overview

popPhyl_PCA

Performs PCA of genotypes.
Works in two steps.

1. Input file

A single fasta file containing different loci, in different populations/species. Not necessarily sorted.
The ID (the line starting by >) of each sequence has to respect the following format:
`

E24_99631_p1|arabidopsis|E15|Allele_1 NNNNNNNNNNNAAAGAAGATGGCGTCGGCAGTTTCAGTATCGTTTATTGTGGTGAATATT TTGCTTCTCCTGGTTCAGGTCTTTGCTGGGAGAGACTTTTACAAAATATTGGGAGTTCCC AGAAACGCCGATTTGAAACAAATCAAGCGATCCTATCGAAAGCTGGCCAAAGAACTCCAC CCAGATAAGAACAAAGATGATCCTGAAGCAGAACAAAGATTTCAAGACTTAGGTGCTGCT ` Four different fields separated by a pipe (|), where:

  1. first field is the locus name (E24_99631_p1).
  2. second field is the species name (arabidopsis).
  3. third field is the name of the sampled diploid individual (E15).
  4. fourth field is the name of the allele (two alleles per individual, named either Allele_1 or Allele_2)

1. PCA

Single python command line (popphyl2PCA.py).
Before, you need to have these python dependencies available:

  1. pandas
  2. sklearn
  3. biopython

python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py [name of the subdirectory created by the script where output files will be written] [name of the input fasta file]

Example:
python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py ~/Documents/PCA/testPCA ~/Programmes/popPhyl_PCA/test.fas
Can takes between 10 minutes and 2 hours, depending on the number of SNPs and individuals.

2. vizualisation

Little Shiny interface (plotPCA.R).
Before, you need to have these R dependencies available:

  1. shiny
  2. plotly
  3. tidyverse
  4. shinycssloaders

Then, in R:

  1. source(~/Programmes/popPhyl_PCA/plotPCA.R)
  2. shinyApp(ui=ui, server=server)
  3. upload the files with coordinates (table_coord_PCA_genotypes.txt) and eigen values (table_eigen_PCA_genotypes.txt)
Owner
camille roux
PostDoc in Population Genomics; Speciation; Hybridization; Evolution of sex chromosomes; Backward+forward simulations.
camille roux
An OData v4 query parser and transpiler for Python

odata-query is a library that parses OData v4 filter strings, and can convert them to other forms such as Django Queries, SQLAlchemy Queries, or just plain SQL.

Gorilla 39 Jan 05, 2023
✨ Voici un code en Python par moi, et en français qui permet de générer du texte Lorem.

Lorem Gen ❗ Voici un code en Python par moi, et en français qui permet de générer du texte Lorem. Dépendences : pip install lorem_text 💖 Enjoy 🎫 Mon

MrGabin 3 Jun 07, 2021
Numbers-parser - Python module for parsing Apple Numbers .numbers files

numbers-parser numbers-parser is a Python module for parsing Apple Numbers .numbers files. It supports Numbers files generated by Numbers version 10.3

Jon Connell 154 Jan 05, 2023
Check the basic quality of any dataset

Data Quality Checker in Python Check the basic quality of any dataset. Sneak Peek Read full tutorial at Medium. Explore the app Requirements python 3.

MalaDeep 8 Feb 23, 2022
Simple RGB to HEX game made in python

Simple RGB to HEX game made in python

5 Aug 26, 2022
Simple tool for creating changelogs

Description Simple utility for quickly generating changelogs, assuming your commits are ordered as they should be. This tool will simply log all lates

2 Jan 05, 2022
Auto-generate /etc/hosts for HackTheBox machines

Auto-generate /etc/hosts for HackTheBox machines Save yourself some tedium on getting started on a new machine by having your /etc/hosts ready to go.

3 Feb 16, 2022
Keval allows you to call arbitrary Windows kernel-mode functions from user mode, even (and primarily) on another machine.

Keval Keval allows you to call arbitrary Windows kernel-mode functions from user mode, even (and primarily) on another machine. The user mode portion

42 Dec 17, 2022
Simple yet flexible natural sorting in Python.

natsort Simple yet flexible natural sorting in Python. Source Code: https://github.com/SethMMorton/natsort Downloads: https://pypi.org/project/natsort

Seth Morton 712 Dec 23, 2022
NetConfParser is a tool that helps you analyze the rpcs coming and going from a netconf client to a server

NetConfParser is a tool that helps you analyze the rpcs coming and going from a netconf client to a server

Aero 1 Mar 31, 2022
Tool to produce system call tables from Linux source code.

Syscalls Tool to generate system call tables from the linux source tree. Example The following will produce a markdown (.md) file containing the table

7 Jul 30, 2022
ColorController is a Pythonic interface for managing colors by english-language name and various color values.

ColorController.py Table of Contents Encode color data in various formats. 1.1: Create a ColorController object using a familiar, english-language col

Tal Zaken 2 Feb 12, 2022
Script to decrypt / import chromium (edge/chrome) cookies

Cloonie Script to decrypt / import chromium (edge/chrome) cookies. Requirements Install the python dependencies via pip: pip install -r requirements.t

Lorenzo Bernardi 5 Sep 13, 2022
Hot reloading for Python

Hot reloading for Python

Olivier Breuleux 769 Jan 03, 2023
A repo for working with and building daos

DAO Mix DAO Mix About How to DAO No Code Tools Getting Started Prerequisites Installation Usage On-Chain Governance Example Off-Chain governance Examp

Brownie Mixes 86 Dec 19, 2022
Adding two matrix from scratch using python.

Adding-two-matrix-from-scratch-using-python. Here, I have take two matrix from user and add it without using any library. I made this program from scr

Sachin Vinayak Dabhade 4 Sep 24, 2021
An okayish python script to generate a random Euler circuit with given number of vertices and edges.

Euler-Circuit-Test-Case-Generator An okayish python script to generate a random Euler circuit with given number of vertices and edges. Executing the S

Alen Antony 1 Nov 13, 2021
An URL checking python module

An URL checking python module

Fayas Noushad 6 Aug 10, 2022
Python HTTP Agent Parser

Features Fast Detects OS and Browser. Does not aim to be a full featured agent parser Will not turn into django-httpagentparser ;) Usage import ht

Shekhar 213 Dec 06, 2022
Dill_tils is a package that has my commonly used functions inside it for ease of use.

DilllonB07 Utilities Dill_tils is a package that has my commonly used functions inside it for ease of use. Installation Anyone can use this package by

Dillon Barnes 2 Dec 05, 2021