produces PCA on genotypes from fasta files (popPhyl's ID format)

Overview

popPhyl_PCA

Performs PCA of genotypes.
Works in two steps.

1. Input file

A single fasta file containing different loci, in different populations/species. Not necessarily sorted.
The ID (the line starting by >) of each sequence has to respect the following format:
`

E24_99631_p1|arabidopsis|E15|Allele_1 NNNNNNNNNNNAAAGAAGATGGCGTCGGCAGTTTCAGTATCGTTTATTGTGGTGAATATT TTGCTTCTCCTGGTTCAGGTCTTTGCTGGGAGAGACTTTTACAAAATATTGGGAGTTCCC AGAAACGCCGATTTGAAACAAATCAAGCGATCCTATCGAAAGCTGGCCAAAGAACTCCAC CCAGATAAGAACAAAGATGATCCTGAAGCAGAACAAAGATTTCAAGACTTAGGTGCTGCT ` Four different fields separated by a pipe (|), where:

  1. first field is the locus name (E24_99631_p1).
  2. second field is the species name (arabidopsis).
  3. third field is the name of the sampled diploid individual (E15).
  4. fourth field is the name of the allele (two alleles per individual, named either Allele_1 or Allele_2)

1. PCA

Single python command line (popphyl2PCA.py).
Before, you need to have these python dependencies available:

  1. pandas
  2. sklearn
  3. biopython

python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py [name of the subdirectory created by the script where output files will be written] [name of the input fasta file]

Example:
python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py ~/Documents/PCA/testPCA ~/Programmes/popPhyl_PCA/test.fas
Can takes between 10 minutes and 2 hours, depending on the number of SNPs and individuals.

2. vizualisation

Little Shiny interface (plotPCA.R).
Before, you need to have these R dependencies available:

  1. shiny
  2. plotly
  3. tidyverse
  4. shinycssloaders

Then, in R:

  1. source(~/Programmes/popPhyl_PCA/plotPCA.R)
  2. shinyApp(ui=ui, server=server)
  3. upload the files with coordinates (table_coord_PCA_genotypes.txt) and eigen values (table_eigen_PCA_genotypes.txt)
Owner
camille roux
PostDoc in Population Genomics; Speciation; Hybridization; Evolution of sex chromosomes; Backward+forward simulations.
camille roux
✨ Un chois aléatoire d'un article sur Wikipedia totalement fait en Python par moi, et en français.

Wikipedia Random Article ❗ Un chois aléatoire d'un article sur Wikipedia totalement fait en Python par moi, et en français. 🔮 Grâce a une requète a w

MrGabin 4 Jul 18, 2021
Give you a better view of your Docker registry disk usage.

registry-du Give you a better view of your Docker registry disk usage. This small tool will analysis your Docker registry(vanilla or Harbor both work)

Nova Kwok 16 Jan 07, 2023
A Python utility belt containing simple tools, a stdlib like feel, and extra batteries. Hashing, Caching, Timing, Progress, and more made easy!

Ubelt is a small library of robust, tested, documented, and simple functions that extend the Python standard library. It has a flat API that all behav

Jon Crall 638 Dec 13, 2022
UUID version 7, which are time-sortable (following the Peabody RFC4122 draft)

uuid7 - time-sortable UUIDs This module implements the version 7 UUIDs, proposed by Peabody and Davis in https://www.ietf.org/id/draft-peabody-dispatc

Steve Simmons 22 Dec 20, 2022
✨ Voici un code en Python par moi, et en français qui permet de générer du texte Lorem.

Lorem Gen ❗ Voici un code en Python par moi, et en français qui permet de générer du texte Lorem. Dépendences : pip install lorem_text 💖 Enjoy 🎫 Mon

MrGabin 3 Jun 07, 2021
Homebase Name Changer for Fortnite: Save the World.

Homebase Name Changer This program allows you to change the Homebase name in Fortnite: Save the World. How to use it? After starting the HomebaseNameC

PRO100KatYT 7 May 21, 2022
Group imports from Windows binaries

importsort This is a tool that I use to group imports from Windows binaries. Sometimes, you have a gigantic folder full of executables, and you want t

【☆ ゆう ☆ 】 15 Aug 27, 2022
HeadHunter parser

HHparser Description Program for finding work at HeadHunter service Features Find job Parse vacancies Dependencies python pip geckodriver firefox Inst

memphisboy 1 Oct 30, 2021
Display your calendar on the wallpaper.

wallCal Have your calendar appear as the wallpaper. disclaimer Use at your own risk. Don't blame me if you miss a meeting :-) Some parts of the script

7 Jun 14, 2022
Link-tree - Script that iterate over the links found in each page

link-tree Script that iterate over the links found in each page, recursively fin

Rodrigo Stramantinoli 2 Jan 05, 2022
A simple API that will return a key-value pair of randomly generated UUID

A simple API that will return a key-value pair of randomly generated UUID. Key will be a timestamp and value will be UUID. While the server is running, whenever the API is called, it should return al

Pius Lucky 2 Jan 18, 2022
Macro recording and metaprogramming in Python

macro-kit is a package for efficient macro recording and metaprogramming in Python using abstract syntax tree (AST).

8 Aug 31, 2022
Utility to play with ADCS, allows to request tickets and collect information about related objects.

certi Utility to play with ADCS, allows to request tickets and collect information about related objects. Basically, it's the impacket copy of Certify

Eloy 185 Dec 29, 2022
An awesome tool to save articles from RSS feed to Pocket automatically.

RSS2Pocket An awesome tool to save articles from RSS feed to Pocket automatically. About the Project I used to use IFTTT to save articles from RSS fee

Hank Liao 10 Nov 12, 2022
one_click_kag_server is a program which tries to fully automate the creation of a King Arthur's Gold server.

one_click_kag_server is a program which tries to fully automate the creation of a King Arthur's Gold server.

Benjamin Gorman 4 Jan 05, 2022
A program to convert celcius to faranheit. made with python

Temp-Converter What is Temp-Converter Temp-Converter is little program made with pyhton to convert celcius to faranheit. Needed A python interpreter P

Chandula Janith 0 Nov 27, 2021
Extract the download URL from OneDrive or SharePoint share link and push it to aria2

OneDriveShareLinkPushAria2 Extract the download URL from OneDrive or SharePoint share link and push it to aria2 从OneDrive或SharePoint共享链接提取下载URL并将其推送到a

高玩梁 262 Jan 08, 2023
Astvuln is a simple AST scanner which recursively scans a directory, parses each file as AST and runs specified method.

Astvuln Astvuln is a simple AST scanner which recursively scans a directory, parses each file as AST and runs specified method. Some search methods ar

Bitstamp Security 7 May 29, 2022
A Program that generates and checks Stripe keys 24x7.

A Program that generates and checks Stripe keys 24x7. This was made only for Educational Purposes, I'm not responsible for the damages cause by you

iNaveen 18 Dec 17, 2022
Implicit hierarchical a posteriori error estimates in FEniCSx

FEniCSx Error Estimation (FEniCSx-EE) Description FEniCSx-EE is an open source library showing how various error estimation strategies can be implemen

Jack S. Hale 1 Dec 08, 2021