produces PCA on genotypes from fasta files (popPhyl's ID format)

Overview

popPhyl_PCA

Performs PCA of genotypes.
Works in two steps.

1. Input file

A single fasta file containing different loci, in different populations/species. Not necessarily sorted.
The ID (the line starting by >) of each sequence has to respect the following format:
`

E24_99631_p1|arabidopsis|E15|Allele_1 NNNNNNNNNNNAAAGAAGATGGCGTCGGCAGTTTCAGTATCGTTTATTGTGGTGAATATT TTGCTTCTCCTGGTTCAGGTCTTTGCTGGGAGAGACTTTTACAAAATATTGGGAGTTCCC AGAAACGCCGATTTGAAACAAATCAAGCGATCCTATCGAAAGCTGGCCAAAGAACTCCAC CCAGATAAGAACAAAGATGATCCTGAAGCAGAACAAAGATTTCAAGACTTAGGTGCTGCT ` Four different fields separated by a pipe (|), where:

  1. first field is the locus name (E24_99631_p1).
  2. second field is the species name (arabidopsis).
  3. third field is the name of the sampled diploid individual (E15).
  4. fourth field is the name of the allele (two alleles per individual, named either Allele_1 or Allele_2)

1. PCA

Single python command line (popphyl2PCA.py).
Before, you need to have these python dependencies available:

  1. pandas
  2. sklearn
  3. biopython

python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py [name of the subdirectory created by the script where output files will be written] [name of the input fasta file]

Example:
python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py ~/Documents/PCA/testPCA ~/Programmes/popPhyl_PCA/test.fas
Can takes between 10 minutes and 2 hours, depending on the number of SNPs and individuals.

2. vizualisation

Little Shiny interface (plotPCA.R).
Before, you need to have these R dependencies available:

  1. shiny
  2. plotly
  3. tidyverse
  4. shinycssloaders

Then, in R:

  1. source(~/Programmes/popPhyl_PCA/plotPCA.R)
  2. shinyApp(ui=ui, server=server)
  3. upload the files with coordinates (table_coord_PCA_genotypes.txt) and eigen values (table_eigen_PCA_genotypes.txt)
Owner
camille roux
PostDoc in Population Genomics; Speciation; Hybridization; Evolution of sex chromosomes; Backward+forward simulations.
camille roux
A simple toolchain for moving Remarkable highlights to Readwise

A simple toolchain for moving Remarkable highlights to Readwise

zach wick 20 Dec 20, 2022
Local backup made easy, with Python and shutil

KTBackup BETA Local backup made easy, with Python and shutil Features One-command backup and restore Minimalistic (only using stdlib) Convenient direc

kelptaken 1 Dec 27, 2021
This python program will display all SSID usernames and SSID passwords you once connected to your laptop

Windows-Wifi-password-extractor This python program will display all SSID usernames and SSID passwords you once connected to your laptop How to run th

Bhaskar Pal 3 Apr 26, 2022
[P]ython [w]rited [B]inary [C]onverter

pwbinaryc [P]ython [w]rited [Binary] [C]onverter You have rights to: Modify the code and use it private (friends are allowed too) Make a page and redi

0 Jun 21, 2022
.bvh to .mcfunction file converter.

bvh-to-mcf .bvh file to .mcfunction converter

Hanmin Kim 28 Nov 21, 2022
Extract the download URL from OneDrive or SharePoint share link and push it to aria2

OneDriveShareLinkPushAria2 Extract the download URL from OneDrive or SharePoint share link and push it to aria2 从OneDrive或SharePoint共享链接提取下载URL并将其推送到a

高玩梁 262 Jan 08, 2023
A module for account creation with python

A module for account creation with python

Fayas Noushad 3 Dec 01, 2021
A tool written in python to generate basic repo files from github

A tool written in python to generate basic repo files from github

Riley 7 Dec 02, 2021
PyResToolbox - A collection of Reservoir Engineering Utilities

pyrestoolbox A collection of Reservoir Engineering Utilities This set of functio

Mark W. Burgoyne 39 Oct 17, 2022
MicroMIUI - Script to optimize miui and not only

MicroMIUI - Script to optimize miui and not only

Groiznyi-Studio 1 Nov 02, 2021
A hashtag from string extract python module

A hashtag from string extract python module

Fayas Noushad 3 Aug 10, 2022
Helpful functions for use alongside the rich Python library.

🔧 Rich Tools A python package with helpful functions for use alongside with the rich python library. 󠀠󠀠 The current features are: Convert a Pandas

Avi Perl 14 Oct 14, 2022
New time-based UUID formats which are suited for use as a database key

uuid6 New time-based UUID formats which are suited for use as a database key. This module extends immutable UUID objects (the UUID class) with the fun

26 Dec 30, 2022
ticktock is a minimalist library to view Python time performance of Python code.

ticktock is a minimalist library to view Python time performance of Python code.

Victor Benichoux 30 Sep 28, 2022
Python bytecode manipulation and import process customization to do evil stuff with format strings. Nasty!

formathack Python bytecode manipulation and import process customization to do evil stuff with format strings. Nasty! This is an answer to a StackOver

Michiel Van den Berghe 5 Jan 18, 2022
A python app which aggregates and splits costs from multiple public cloud providers into a csv

Cloud Billing This project aggregates the costs public cloud resources by accounts, services and tags by importing the invoices from public cloud prov

1 Oct 04, 2022
Search, generate & deliver Msfvenom payloads in an quick and easy way

Goal Search, generate & deliver payloads in an quick and easy way Be as simple as possible BUT with all msfvenom payloads. Ever lost time searching th

2 Mar 03, 2022
Create powerful passwords easily and with many options with this program

Password_Generator About the Program: You can create powerful passwords with this program with many options easily! Features: You can copy the generat

Sina.f 0 Jul 14, 2022
Teleport Ur Logs with Love

Whatever you pipe into tull, will get a unique UUID and the data gets stored locally - accessible via a flask server with simple endpoints. You can use ngrok or localtunnel then to share it outside L

Lokendra Sharma 11 Jul 30, 2021
These scripts look for non-printable unicode characters in all text files in a source tree

find-unicode-control These scripts look for non-printable unicode characters in all text files in a source tree. find_unicode_control.py should work w

Siddhesh Poyarekar 25 Aug 30, 2022