produces PCA on genotypes from fasta files (popPhyl's ID format)

Overview

popPhyl_PCA

Performs PCA of genotypes.
Works in two steps.

1. Input file

A single fasta file containing different loci, in different populations/species. Not necessarily sorted.
The ID (the line starting by >) of each sequence has to respect the following format:
`

E24_99631_p1|arabidopsis|E15|Allele_1 NNNNNNNNNNNAAAGAAGATGGCGTCGGCAGTTTCAGTATCGTTTATTGTGGTGAATATT TTGCTTCTCCTGGTTCAGGTCTTTGCTGGGAGAGACTTTTACAAAATATTGGGAGTTCCC AGAAACGCCGATTTGAAACAAATCAAGCGATCCTATCGAAAGCTGGCCAAAGAACTCCAC CCAGATAAGAACAAAGATGATCCTGAAGCAGAACAAAGATTTCAAGACTTAGGTGCTGCT ` Four different fields separated by a pipe (|), where:

  1. first field is the locus name (E24_99631_p1).
  2. second field is the species name (arabidopsis).
  3. third field is the name of the sampled diploid individual (E15).
  4. fourth field is the name of the allele (two alleles per individual, named either Allele_1 or Allele_2)

1. PCA

Single python command line (popphyl2PCA.py).
Before, you need to have these python dependencies available:

  1. pandas
  2. sklearn
  3. biopython

python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py [name of the subdirectory created by the script where output files will be written] [name of the input fasta file]

Example:
python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py ~/Documents/PCA/testPCA ~/Programmes/popPhyl_PCA/test.fas
Can takes between 10 minutes and 2 hours, depending on the number of SNPs and individuals.

2. vizualisation

Little Shiny interface (plotPCA.R).
Before, you need to have these R dependencies available:

  1. shiny
  2. plotly
  3. tidyverse
  4. shinycssloaders

Then, in R:

  1. source(~/Programmes/popPhyl_PCA/plotPCA.R)
  2. shinyApp(ui=ui, server=server)
  3. upload the files with coordinates (table_coord_PCA_genotypes.txt) and eigen values (table_eigen_PCA_genotypes.txt)
Owner
camille roux
PostDoc in Population Genomics; Speciation; Hybridization; Evolution of sex chromosomes; Backward+forward simulations.
camille roux
A Python utility belt containing simple tools, a stdlib like feel, and extra batteries. Hashing, Caching, Timing, Progress, and more made easy!

Ubelt is a small library of robust, tested, documented, and simple functions that extend the Python standard library. It has a flat API that all behav

Jon Crall 638 Dec 13, 2022
A workflow management tool for numerical models on the NCI computing systems

Payu Payu is a climate model workflow management tool for supercomputing environments. Payu is currently only configured for use on computing clusters

The Payu Organization 11 Aug 25, 2022
A tiny Python library for generating public IDs from integers

pids Create short public identifiers based on integer IDs. Installation pip install pids Usage from pids import pid public_id = pid.from_int(1234) #

Simon Willison 7 Nov 11, 2021
A repo for working with and building daos

DAO Mix DAO Mix About How to DAO No Code Tools Getting Started Prerequisites Installation Usage On-Chain Governance Example Off-Chain governance Examp

Brownie Mixes 86 Dec 19, 2022
Early version for manipulate Geo localization data trough API REST.

Backend para obtener los datos (beta) Descripción El servidor está diseñado para recibir y almacenar datos enviados en forma de JSON por una aplicació

Víctor Omar Vento Hernández 1 Nov 14, 2021
Spacegit is a .git exposed finder

Spacegit Spacegit is a basic .git exposed finder Usage: You need python3 installed to run spacegit use: python3 spacegit.py (url) Disclaimer: **This i

2 Nov 30, 2021
Python based tool to extract forensic info from EventTranscript.db (Windows Diagnostic Data)

EventTranscriptParser EventTranscriptParser is python based tool to extract forensically useful details from EventTranscript.db (Windows Diagnostic Da

P. Abhiram Kumar 24 Nov 18, 2022
Minimal Windows system information tool written in Python

wfetch wfetch is a Minimal Windows system information tool written in Python (Only works on Windows) Installation First of all have python installed.

zJairO 3 Jan 24, 2022
This is Cool Utility tools that you can use in python.

This is Cool Utility tools that you can use in python. There are a few tools that you might find very useful, you can use this on pretty much any project and some utils might help you a lot and save

Senarc Studios 6 Apr 18, 2022
Grank is a feature-rich script that automatically grinds Dank Memer for you

Grank Inspired by this repository. This is a WIP and there will be more functions added in the future. What is Grank? Grank is a feature-rich script t

42 Jul 20, 2022
Standard implementations of FedLab and its provided benchmarks.

FedLab-benchmarks This repo contains standard implementations of FedLab and its provided benchmarks. Currently, following algorithms or benchrmarks ar

SMILELab-FL 104 Dec 05, 2022
Playing with python imports and inducing those pesky errors.

super-duper-python-imports In this repository we are playing with python imports and inducing those pesky ImportErrors. File Organization project │

James Kelsey 2 Oct 14, 2021
A Program that generates and checks Stripe keys 24x7.

A Program that generates and checks Stripe keys 24x7. This was made only for Educational Purposes, I'm not responsible for the damages cause by you

iNaveen 18 Dec 17, 2022
python script to generate color coded resistor images

Resistor image generator I got nerdsniped into making this. It's not finished at all, and the code is messy. The end goal it generate a whole E-series

MichD 1 Nov 12, 2021
Small Python script to parse endlessh's output and print some neat statistics

endlessh_parser endlessh_parser is a small Python script that parses endlessh's output and prints some neat statistics about it Usage Install all the

ManicRobot 1 Oct 18, 2021
This is discord nitro code generator and checker made with python. This will generate nitro codes and checks if the code is valid or not. If code is valid then it will print the code leaving 2 lines and if not then it will print '*'.

Discord Nitro Generator And Checker ⚙️ Rᴜɴ Oɴ Rᴇᴘʟɪᴛ 🛠️ Lᴀɴɢᴜᴀɢᴇs Aɴᴅ Tᴏᴏʟs If you are taking code from this repository without a fork, then atleast

Vɪɴᴀʏᴀᴋ Pᴀɴᴅᴇʏ 37 Jan 07, 2023
A simple Python app that generates semi-random chord progressions.

chords-generator A simple Python app that generates semi-random chord progressions.

53 Sep 07, 2022
produces PCA on genotypes from fasta files (popPhyl's ID format)

popPhyl_PCA Performs PCA of genotypes. Works in two steps. 1. Input file A single fasta file containing different loci, in different populations/speci

camille roux 2 Oct 08, 2021
Python humanize functions

humanize This modest package contains various common humanization utilities, like turning a number into a fuzzy human-readable duration ("3 minutes ag

Jason Moiron 1.6k Jan 01, 2023
Random Name and Slug Generator

Random Name and Slug Generator

Alexander Lukanin 104 Nov 30, 2022