produces PCA on genotypes from fasta files (popPhyl's ID format)

Overview

popPhyl_PCA

Performs PCA of genotypes.
Works in two steps.

1. Input file

A single fasta file containing different loci, in different populations/species. Not necessarily sorted.
The ID (the line starting by >) of each sequence has to respect the following format:
`

E24_99631_p1|arabidopsis|E15|Allele_1 NNNNNNNNNNNAAAGAAGATGGCGTCGGCAGTTTCAGTATCGTTTATTGTGGTGAATATT TTGCTTCTCCTGGTTCAGGTCTTTGCTGGGAGAGACTTTTACAAAATATTGGGAGTTCCC AGAAACGCCGATTTGAAACAAATCAAGCGATCCTATCGAAAGCTGGCCAAAGAACTCCAC CCAGATAAGAACAAAGATGATCCTGAAGCAGAACAAAGATTTCAAGACTTAGGTGCTGCT ` Four different fields separated by a pipe (|), where:

  1. first field is the locus name (E24_99631_p1).
  2. second field is the species name (arabidopsis).
  3. third field is the name of the sampled diploid individual (E15).
  4. fourth field is the name of the allele (two alleles per individual, named either Allele_1 or Allele_2)

1. PCA

Single python command line (popphyl2PCA.py).
Before, you need to have these python dependencies available:

  1. pandas
  2. sklearn
  3. biopython

python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py [name of the subdirectory created by the script where output files will be written] [name of the input fasta file]

Example:
python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py ~/Documents/PCA/testPCA ~/Programmes/popPhyl_PCA/test.fas
Can takes between 10 minutes and 2 hours, depending on the number of SNPs and individuals.

2. vizualisation

Little Shiny interface (plotPCA.R).
Before, you need to have these R dependencies available:

  1. shiny
  2. plotly
  3. tidyverse
  4. shinycssloaders

Then, in R:

  1. source(~/Programmes/popPhyl_PCA/plotPCA.R)
  2. shinyApp(ui=ui, server=server)
  3. upload the files with coordinates (table_coord_PCA_genotypes.txt) and eigen values (table_eigen_PCA_genotypes.txt)
Owner
camille roux
PostDoc in Population Genomics; Speciation; Hybridization; Evolution of sex chromosomes; Backward+forward simulations.
camille roux
Homebase Name Changer for Fortnite: Save the World.

Homebase Name Changer This program allows you to change the Homebase name in Fortnite: Save the World. How to use it? After starting the HomebaseNameC

PRO100KatYT 7 May 21, 2022
Aggregating gridded data (xarray) to polygons

A package to aggregate gridded data in xarray to polygons in geopandas using area-weighting from the relative area overlaps between pixels and polygons.

Kevin Schwarzwald 42 Nov 09, 2022
We provide useful util functions. When adding a util function, please add a description of the util function.

Utils Collection Motivation When we implement codes, we often search for util functions that are already implemented. Here, we are going to share util

6 Sep 09, 2021
A library from RCTI+ to handle RabbitMQ tasks (connect, send, receive, etc) in Python.

Introduction A library from RCTI+ to handle RabbitMQ tasks (connect, send, receive, etc) in Python. Requirements Python =3.7.3 Pika ==1.2.0 Aio-pika

Dali Kewara 1 Feb 05, 2022
Python utility for discovering interesting CFPreferences values on iDevices

Description Simple utility to search for interesting preferences in iDevices. Installation python3 -m pip install -U --user cfprefsmon Example In this

12 Aug 19, 2022
Every 2 minutes, check for visa slots at VFS website

vfs-visa-slot-germany Every 2 minutes, check for visa slots at VFS website. If there are any, send a call and a message of the format: Sent from your

12 Dec 15, 2022
Spacegit is a .git exposed finder

Spacegit Spacegit is a basic .git exposed finder Usage: You need python3 installed to run spacegit use: python3 spacegit.py (url) Disclaimer: **This i

2 Nov 30, 2021
Audio Steganography is a technique used to transmit hidden information by modifying an audio signal in an imperceptible manner.

Audio Steganography Audio Steganography is a technique used to transmit hidden information by modifying an audio signal in an imperceptible manner. Ab

Karan Yuvraj Singh 1 Oct 17, 2021
A library to easily convert climbing route grades between different grading systems.

pyclimb A library to easily convert climbing route grades between different grading systems. In rock climbing, mountaineering, and other climbing disc

Ilias Antonopoulos 4 Jan 26, 2022
Keval allows you to call arbitrary Windows kernel-mode functions from user mode, even (and primarily) on another machine.

Keval Keval allows you to call arbitrary Windows kernel-mode functions from user mode, even (and primarily) on another machine. The user mode portion

42 Dec 17, 2022
A simple python implementation of Decision Tree.

DecisionTree A simple python implementation of Decision Tree, using Gini index. Usage: import DecisionTree node = DecisionTree.trainDecisionTree(lab

1 Nov 12, 2021
[P]ython [w]rited [B]inary [C]onverter

pwbinaryc [P]ython [w]rited [Binary] [C]onverter You have rights to: Modify the code and use it private (friends are allowed too) Make a page and redi

0 Jun 21, 2022
A Python script that parses and checks public proxies. Multithreading is supported.

A Python script that parses and checks public proxies. Multithreading is supported.

LevPrav 7 Nov 25, 2022
A Program that generates and checks Stripe keys 24x7.

A Program that generates and checks Stripe keys 24x7. This was made only for Educational Purposes, I'm not responsible for the damages cause by you

iNaveen 18 Dec 17, 2022
Michael Vinyard's utilities

Install vintools To download this package from pypi: pip install vintools Install the development package To download and install the developmen

Michael Vinyard 2 May 22, 2022
A time table app to notify the user about their class timings

kivyTimeTable A time table app to notify the user about their class timings Features This project incorporates some features i wanted to see in a time

2 Dec 15, 2021
Fuzzy box is a quick program I wrote to fuzz a URL that is in the format https:// url 20characterstring.

What is this? Fuzzy box is a quick program I wrote to fuzz a URL that is in the format https://url/20characterstring.extension. I have redacted th

Graham Helton 1 Oct 19, 2021
Color getter (including method to get random color or complementary color) made out of Python

python-color-getter Color getter (including method to get random color or complementary color) made out of Python Setup pip3 install git+https://githu

Jung Gyu Yoon 2 Sep 17, 2022
Fcpy: A Python package for high performance, fast convergence and high precision numerical fractional calculus computing.

Fcpy: A Python package for high performance, fast convergence and high precision numerical fractional calculus computing.

SciFracX 1 Mar 23, 2022
Lock files using python and cmd

Python_Lock_Files Lock files using python and cmd license feel free to do whatever you want to with these files, i dont take any responsibility tho, u

1 Nov 01, 2021