produces PCA on genotypes from fasta files (popPhyl's ID format)

Overview

popPhyl_PCA

Performs PCA of genotypes.
Works in two steps.

1. Input file

A single fasta file containing different loci, in different populations/species. Not necessarily sorted.
The ID (the line starting by >) of each sequence has to respect the following format:
`

E24_99631_p1|arabidopsis|E15|Allele_1 NNNNNNNNNNNAAAGAAGATGGCGTCGGCAGTTTCAGTATCGTTTATTGTGGTGAATATT TTGCTTCTCCTGGTTCAGGTCTTTGCTGGGAGAGACTTTTACAAAATATTGGGAGTTCCC AGAAACGCCGATTTGAAACAAATCAAGCGATCCTATCGAAAGCTGGCCAAAGAACTCCAC CCAGATAAGAACAAAGATGATCCTGAAGCAGAACAAAGATTTCAAGACTTAGGTGCTGCT ` Four different fields separated by a pipe (|), where:

  1. first field is the locus name (E24_99631_p1).
  2. second field is the species name (arabidopsis).
  3. third field is the name of the sampled diploid individual (E15).
  4. fourth field is the name of the allele (two alleles per individual, named either Allele_1 or Allele_2)

1. PCA

Single python command line (popphyl2PCA.py).
Before, you need to have these python dependencies available:

  1. pandas
  2. sklearn
  3. biopython

python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py [name of the subdirectory created by the script where output files will be written] [name of the input fasta file]

Example:
python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py ~/Documents/PCA/testPCA ~/Programmes/popPhyl_PCA/test.fas
Can takes between 10 minutes and 2 hours, depending on the number of SNPs and individuals.

2. vizualisation

Little Shiny interface (plotPCA.R).
Before, you need to have these R dependencies available:

  1. shiny
  2. plotly
  3. tidyverse
  4. shinycssloaders

Then, in R:

  1. source(~/Programmes/popPhyl_PCA/plotPCA.R)
  2. shinyApp(ui=ui, server=server)
  3. upload the files with coordinates (table_coord_PCA_genotypes.txt) and eigen values (table_eigen_PCA_genotypes.txt)
Owner
camille roux
PostDoc in Population Genomics; Speciation; Hybridization; Evolution of sex chromosomes; Backward+forward simulations.
camille roux
Script for generating Hearthstone card spoilers & checklists

This is a script for generating text spoilers and set checklists for Hearthstone. Installation & Running Python 3.6 or higher is required. Copy/clone

John T. Wodder II 1 Oct 11, 2022
python script to generate color coded resistor images

Resistor image generator I got nerdsniped into making this. It's not finished at all, and the code is messy. The end goal it generate a whole E-series

MichD 1 Nov 12, 2021
Shut is an opinionated tool to simplify publishing pure Python packages.

Welcome to Shut Shut is an opinionated tool to simplify publishing pure Python packages. What can Shut do for you? Generate setup files (setup.py, MAN

Niklas Rosenstein 6 Nov 18, 2022
Conveniently measures the time of your loops, contexts and functions.

Conveniently measures the time of your loops, contexts and functions.

Maciej J Mikulski 79 Nov 15, 2022
Find version automatically based on git tags and commit messages.

GIT-CONVENTIONAL-VERSION Find version automatically based on git tags and commit messages. The tool is very specific in its function, so it is very fl

0 Nov 07, 2021
The Black shade analyser and comparison tool.

diff-shades The Black shade analyser and comparison tool. AKA Richard's personal take at a better black-primer (by stealing ideas from mypy-primer) :p

Richard Si 10 Apr 29, 2022
Color getter (including method to get random color or complementary color) made out of Python

python-color-getter Color getter (including method to get random color or complementary color) made out of Python Setup pip3 install git+https://githu

Jung Gyu Yoon 2 Sep 17, 2022
Automatic generator of readmes for git repositories (Includes file' listing)

Readme Generator We are bored of write the same things once and once again. We trust in the comments made inside of our files, and we decided to autom

Natalia Vera Duran 6 Jul 20, 2021
✨ Un bot Twitter totalement fait en Python par moi, et en français.

Twitter Bot ❗ Un bot Twitter totalement fait en Python par moi, et en français. Il faut remplacer auth = tweepy.OAuthHandler(consumer_key, consumer_se

MrGabin 3 Jun 06, 2021
Handy Tool to check the availability of onion site and to extract the title of submitted onion links.

This tool helps is to quickly investigate a huge set of onion sites based by checking its availability which helps to filter out the inactive sites and collect the site title that might helps us to c

Balaji 13 Nov 25, 2022
extract gene TSS/TES site form gencode/ensembl/gencode database GTF file and export bed format file.

GetTsite python Package extract gene TSS/TES site form gencode/ensembl/gencode database GTF file and export bed format file. Install $ pip install Get

laojunjun 7 Nov 21, 2022
Random Number Generator Analysis With Python

Random-Number-Generator-Analysis Governor's Honors Program Project to determine

Jack Prewitt 2 Jan 23, 2022
PyGMT - A Python interface for the Generic Mapping Tools

PyGMT A Python interface for the Generic Mapping Tools Documentation (development version) | Contact | Try Online Why PyGMT? A beautiful map is worth

The Generic Mapping Tools (GMT) 564 Dec 28, 2022
This two python programs can convert km to miles and miles to km

km-to-miles These two little python programs can convert kilometers to miles and miles to kilometers Needed Python3 or a online python compiler with t

Chandula Janith 3 Jan 30, 2022
Simple code to generate a password for your account!

Password-Generator Simple code to generate a password for your account! Password Generator for passwords for your accounts or anything else! This code

DEEM 1 Jun 05, 2022
Standard implementations of FedLab and its provided benchmarks.

FedLab-benchmarks This repo contains standard implementations of FedLab and its provided benchmarks. Currently, following algorithms or benchrmarks ar

SMILELab-FL 104 Dec 05, 2022
A dictionary that can be flattened and re-inflated

deflatable-dict A dictionary that can be flattened and re-inflated. Particularly useful if you're interacting with yaml, for example. Installation wit

Lucas Sargent 2 Oct 18, 2021
Blender 2.93 addon for loading Quake II MD2 files

io_mesh_md2 is a Blender 2.93 addon for importing Quake II MD2 files.

Joshua Skelton 11 Aug 31, 2022
cpp20.py is a Python script to compile C++20 code using modules.

cpp20.py is a Python script to compile C++20 code using modules. It browses the source files to determine their dependencies. Then, it compiles then in order using the correct flags.

Julien VERNAY 6 Aug 26, 2022
A Python script that parses and checks public proxies. Multithreading is supported.

A Python script that parses and checks public proxies. Multithreading is supported.

LevPrav 7 Nov 25, 2022