produces PCA on genotypes from fasta files (popPhyl's ID format)

Overview

popPhyl_PCA

Performs PCA of genotypes.
Works in two steps.

1. Input file

A single fasta file containing different loci, in different populations/species. Not necessarily sorted.
The ID (the line starting by >) of each sequence has to respect the following format:
`

E24_99631_p1|arabidopsis|E15|Allele_1 NNNNNNNNNNNAAAGAAGATGGCGTCGGCAGTTTCAGTATCGTTTATTGTGGTGAATATT TTGCTTCTCCTGGTTCAGGTCTTTGCTGGGAGAGACTTTTACAAAATATTGGGAGTTCCC AGAAACGCCGATTTGAAACAAATCAAGCGATCCTATCGAAAGCTGGCCAAAGAACTCCAC CCAGATAAGAACAAAGATGATCCTGAAGCAGAACAAAGATTTCAAGACTTAGGTGCTGCT ` Four different fields separated by a pipe (|), where:

  1. first field is the locus name (E24_99631_p1).
  2. second field is the species name (arabidopsis).
  3. third field is the name of the sampled diploid individual (E15).
  4. fourth field is the name of the allele (two alleles per individual, named either Allele_1 or Allele_2)

1. PCA

Single python command line (popphyl2PCA.py).
Before, you need to have these python dependencies available:

  1. pandas
  2. sklearn
  3. biopython

python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py [name of the subdirectory created by the script where output files will be written] [name of the input fasta file]

Example:
python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py ~/Documents/PCA/testPCA ~/Programmes/popPhyl_PCA/test.fas
Can takes between 10 minutes and 2 hours, depending on the number of SNPs and individuals.

2. vizualisation

Little Shiny interface (plotPCA.R).
Before, you need to have these R dependencies available:

  1. shiny
  2. plotly
  3. tidyverse
  4. shinycssloaders

Then, in R:

  1. source(~/Programmes/popPhyl_PCA/plotPCA.R)
  2. shinyApp(ui=ui, server=server)
  3. upload the files with coordinates (table_coord_PCA_genotypes.txt) and eigen values (table_eigen_PCA_genotypes.txt)
Owner
camille roux
PostDoc in Population Genomics; Speciation; Hybridization; Evolution of sex chromosomes; Backward+forward simulations.
camille roux
A repo for working with and building daos

DAO Mix DAO Mix About How to DAO No Code Tools Getting Started Prerequisites Installation Usage On-Chain Governance Example Off-Chain governance Examp

Brownie Mixes 86 Dec 19, 2022
A tiny Python library for generating public IDs from integers

pids Create short public identifiers based on integer IDs. Installation pip install pids Usage from pids import pid public_id = pid.from_int(1234) #

Simon Willison 7 Nov 11, 2021
A plugin to simplify creating multi-page Dash apps

Multi-Page Dash App Plugin A plugin to simplify creating multi-page Dash apps. This is a preview of functionality that will of Dash 2.1. Background Th

Plotly 19 Dec 09, 2022
The git for the Python Story Utility Package library.

SUP The git for the Python Story Utility Package library. Installation: Install SUP by simply running pip install psup in your terminal. Check out our

Enoki 6 Nov 27, 2022
Check username

Checker-Oukee Check username It checks the available usernames and creates a new account for them Doesn't need proxies Create a file with usernames an

4 Jun 05, 2022
A collection of common regular expressions bundled with an easy to use interface.

CommonRegex Find all times, dates, links, phone numbers, emails, ip addresses, prices, hex colors, and credit card numbers in a string. We did the har

Madison May 1.5k Dec 31, 2022
Format Norminette Output!

Format Norminette Output!

7 Apr 19, 2022
Dependency injection lib for Python 3.8+

PyDI Dependency injection lib for python How to use To define the classes that should be injected and stored as bean use decorator @component @compone

Nikita Antropov 2 Nov 09, 2021
pydsinternals - A Python native library containing necessary classes, functions and structures to interact with Windows Active Directory.

pydsinternals - Directory Services Internals Library A Python native library containing necessary classes, functions and structures to interact with W

Podalirius 36 Dec 14, 2022
ColorController is a Pythonic interface for managing colors by english-language name and various color values.

ColorController.py Table of Contents Encode color data in various formats. 1.1: Create a ColorController object using a familiar, english-language col

Tal Zaken 2 Feb 12, 2022
Set of utilities for exporting/controlling your robot in Blender

Blender Robotics Utils This repository contains utilities for exporting/controlling your robot in Blender Maintainers This repository is maintained by

Robotology 33 Nov 30, 2022
This is a tool to calculate a resulting color of the alpha blending process.

blec: alpha blending calculator This is a tool to calculate a resulting color of the alpha blending process. A gamma correction is enabled and the def

Igor Mikushkin 12 Sep 07, 2022
Extract XML from the OS X dictionaries.

Extract XML from the OS X dictionaries.

Joshua Olson 13 Dec 11, 2022
Package that allows for validate and sanitize of string values.

py.validator A library of string validators and sanitizers Insipired by validator.js Strings only This library validates and sanitizes strings only. P

Sanel Hadzini 22 Nov 08, 2022
Trying to replicate (albeit unsuccessfully) the phenomenon of boids using Ursina in a naive manner.

Boids_Boi Trying to replicate (albeit unsuccessfully) the phenomenon of boids using Ursina in a naive manner. Please install the Ursina module before

2 Oct 19, 2021
A color library based on pokemons colors!

pokepalette A simple pokemon color chooser " This repo is based on CDWimmer/PokePalette and was originated from this tweet. If you don't remember your

Thomas Capelle 5 Aug 30, 2021
A simple and easy to use collection of random python functions.

A simple and easy to use collection of random python functions.

Diwan Mohamed Faheer 1 Nov 17, 2021
Python utilities for writing cross-version compatible libraries

Python utilities for writing cross-version compatible libraries

Tyler M. Kontra 85 Jun 29, 2022
Automatic generator of readmes for git repositories (Includes file' listing)

Readme Generator We are bored of write the same things once and once again. We trust in the comments made inside of our files, and we decided to autom

Natalia Vera Duran 6 Jul 20, 2021
Use generator for range function

Use the generator for the range function! installation method: pip install yrange How to use: First import yrange in your application. You can then wo

1 Oct 28, 2021