produces PCA on genotypes from fasta files (popPhyl's ID format)

Overview

popPhyl_PCA

Performs PCA of genotypes.
Works in two steps.

1. Input file

A single fasta file containing different loci, in different populations/species. Not necessarily sorted.
The ID (the line starting by >) of each sequence has to respect the following format:
`

E24_99631_p1|arabidopsis|E15|Allele_1 NNNNNNNNNNNAAAGAAGATGGCGTCGGCAGTTTCAGTATCGTTTATTGTGGTGAATATT TTGCTTCTCCTGGTTCAGGTCTTTGCTGGGAGAGACTTTTACAAAATATTGGGAGTTCCC AGAAACGCCGATTTGAAACAAATCAAGCGATCCTATCGAAAGCTGGCCAAAGAACTCCAC CCAGATAAGAACAAAGATGATCCTGAAGCAGAACAAAGATTTCAAGACTTAGGTGCTGCT ` Four different fields separated by a pipe (|), where:

  1. first field is the locus name (E24_99631_p1).
  2. second field is the species name (arabidopsis).
  3. third field is the name of the sampled diploid individual (E15).
  4. fourth field is the name of the allele (two alleles per individual, named either Allele_1 or Allele_2)

1. PCA

Single python command line (popphyl2PCA.py).
Before, you need to have these python dependencies available:

  1. pandas
  2. sklearn
  3. biopython

python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py [name of the subdirectory created by the script where output files will be written] [name of the input fasta file]

Example:
python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py ~/Documents/PCA/testPCA ~/Programmes/popPhyl_PCA/test.fas
Can takes between 10 minutes and 2 hours, depending on the number of SNPs and individuals.

2. vizualisation

Little Shiny interface (plotPCA.R).
Before, you need to have these R dependencies available:

  1. shiny
  2. plotly
  3. tidyverse
  4. shinycssloaders

Then, in R:

  1. source(~/Programmes/popPhyl_PCA/plotPCA.R)
  2. shinyApp(ui=ui, server=server)
  3. upload the files with coordinates (table_coord_PCA_genotypes.txt) and eigen values (table_eigen_PCA_genotypes.txt)
Owner
camille roux
PostDoc in Population Genomics; Speciation; Hybridization; Evolution of sex chromosomes; Backward+forward simulations.
camille roux
Let's renew the puzzle collection. We'll produce a collection of new puzzles out of the lichess game database.

Let's renew the puzzle collection. We'll produce a collection of new puzzles out of the lichess game database.

Thibault Duplessis 96 Jan 03, 2023
An okayish python script to generate a random Euler circuit with given number of vertices and edges.

Euler-Circuit-Test-Case-Generator An okayish python script to generate a random Euler circuit with given number of vertices and edges. Executing the S

Alen Antony 1 Nov 13, 2021
aws ec2.py companion script to generate sshconfigs with auto bastion host discovery

ec2-bastion-sshconfig This script will interate over instances found by ec2.py and if those instances are not publically accessible it will search the

Steve Melo 1 Sep 11, 2022
Color getter (including method to get random color or complementary color) made out of Python

python-color-getter Color getter (including method to get random color or complementary color) made out of Python Setup pip3 install git+https://githu

Jung Gyu Yoon 2 Sep 17, 2022
Dynamic key remapper for Wayland Window System, especially for Sway

wayremap Dynamic keyboard remapper for Wayland. It works on both X Window Manager and Wayland, but focused on Wayland as it intercepts evdev input and

Kay Gosho 50 Nov 29, 2022
A simple tool to move and rename Nvidia Share recordings to a more sensible format.

A simple tool to move and rename Nvidia Share recordings to a more sensible format.

Jasper Rebane 8 Dec 23, 2022
Simple web index to use bloom filter for Pwned Passwords

pwbloom Simple web index to use bloom filter for Pwned Passwords The index.py runs a simple CGI web service checking passwords with a bloom filter for

Hanno Böck 4 Nov 23, 2021
[P]ython [w]rited [B]inary [C]onverter

pwbinaryc [P]ython [w]rited [Binary] [C]onverter You have rights to: Modify the code and use it private (friends are allowed too) Make a page and redi

0 Jun 21, 2022
kawadi is a versatile tool that used as a form of weapon and is used to cut, shape and split wood.

kawadi kawadi (કવાડિ in Gujarati) (Axe in English) is a versatile tool that used as a form of weapon and is used to cut, shape and split wood. kawadi

Jay Vala 2 Jan 10, 2022
Just some scripts to export vector tiles to geojson.

Vector tiles to GeoJSON Nowadays modern web maps are usually based on vector tiles. The great thing about vector tiles is, that they are not just imag

Lilith Wittmann 77 Jul 26, 2022
Create password - Generate Random Password with Passphrase

Generate Random Password with Passphrase This is a python code to generate stron

1 Jan 18, 2022
This tool analyzes the json files generated by stream-lnd-htlcs to find hidden channel demand.

analyze_lnd_htlc Introduction Rebalancing channels is an important part of running a Lightning Network node. While it would be great if all channels c

Marimox 4 Dec 08, 2022
A multipurpose python module

pysherlock pysherlock is a Python library for dealing with web scraping using images, it's a Python application of the rendertron headless browser API

Sachit 2 Nov 11, 2021
Dill_tils is a package that has my commonly used functions inside it for ease of use.

DilllonB07 Utilities Dill_tils is a package that has my commonly used functions inside it for ease of use. Installation Anyone can use this package by

Dillon Barnes 2 Dec 05, 2021
A python app which aggregates and splits costs from multiple public cloud providers into a csv

Cloud Billing This project aggregates the costs public cloud resources by accounts, services and tags by importing the invoices from public cloud prov

1 Oct 04, 2022
A python tool give n number of inputs and parallelly you will get a output by separetely

http-status-finder Hello Everyone!! This is kavisurya, In this tool you can give n number of inputs and parallelly you will get a output by separetely

KAVISURYA V 3 Dec 05, 2021
Control-Alt-Delete - Help Tux Escape Beastie's Jail!

Control-Alt-Delete Help Tux escape Beastie's jail by completing the following challenges! Challenges Challenge 00: Drinks: Tux needs to drink less. Ch

NDLUG 8 Oct 31, 2021
Allows you to canibalize methods from classes effectively implementing trait-oriented programming

About This package enables code reuse in non-inheritance way from existing classes, effectively implementing traits-oriented programming pattern. Stor

1 Dec 13, 2021
general-phylomoji: a phylogenetic tree of emoji

general-phylomoji: a phylogenetic tree of emoji

2 Dec 11, 2021
Airspy-Utils is a small software collection to help with firmware related operations on Airspy HF+ devices.

Airspy-Utils Airspy-Utils is a small software collection to help with firmware related operations on Airspy HF+ devices on Linux (and other free syste

Dhiru Kholia 11 Oct 04, 2022