produces PCA on genotypes from fasta files (popPhyl's ID format)

Overview

popPhyl_PCA

Performs PCA of genotypes.
Works in two steps.

1. Input file

A single fasta file containing different loci, in different populations/species. Not necessarily sorted.
The ID (the line starting by >) of each sequence has to respect the following format:
`

E24_99631_p1|arabidopsis|E15|Allele_1 NNNNNNNNNNNAAAGAAGATGGCGTCGGCAGTTTCAGTATCGTTTATTGTGGTGAATATT TTGCTTCTCCTGGTTCAGGTCTTTGCTGGGAGAGACTTTTACAAAATATTGGGAGTTCCC AGAAACGCCGATTTGAAACAAATCAAGCGATCCTATCGAAAGCTGGCCAAAGAACTCCAC CCAGATAAGAACAAAGATGATCCTGAAGCAGAACAAAGATTTCAAGACTTAGGTGCTGCT ` Four different fields separated by a pipe (|), where:

  1. first field is the locus name (E24_99631_p1).
  2. second field is the species name (arabidopsis).
  3. third field is the name of the sampled diploid individual (E15).
  4. fourth field is the name of the allele (two alleles per individual, named either Allele_1 or Allele_2)

1. PCA

Single python command line (popphyl2PCA.py).
Before, you need to have these python dependencies available:

  1. pandas
  2. sklearn
  3. biopython

python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py [name of the subdirectory created by the script where output files will be written] [name of the input fasta file]

Example:
python3 ~/Programmes/popPhyl_PCA/popphyl2PCA.py ~/Documents/PCA/testPCA ~/Programmes/popPhyl_PCA/test.fas
Can takes between 10 minutes and 2 hours, depending on the number of SNPs and individuals.

2. vizualisation

Little Shiny interface (plotPCA.R).
Before, you need to have these R dependencies available:

  1. shiny
  2. plotly
  3. tidyverse
  4. shinycssloaders

Then, in R:

  1. source(~/Programmes/popPhyl_PCA/plotPCA.R)
  2. shinyApp(ui=ui, server=server)
  3. upload the files with coordinates (table_coord_PCA_genotypes.txt) and eigen values (table_eigen_PCA_genotypes.txt)
Owner
camille roux
PostDoc in Population Genomics; Speciation; Hybridization; Evolution of sex chromosomes; Backward+forward simulations.
camille roux
Daiho Tool is a Script Gathering for Windows/Linux systems written in Python.

Daiho is a Script Developed with Python3. It gathers a total of 22 Discord tools (including a RAT, a Raid Tool, a Nuker Tool, a Token Grabberr, etc). It has a pleasant and intuitive interface to faci

AstraaDev 32 Jan 05, 2023
This project is a set of programs that I use to create a README.md file.

This project is a set of programs that I use to create a README.md file.

Tom Dörr 223 Dec 24, 2022
Produce a simulate-able SDF of an arbitrary mesh with convex decomposition.

Mesh-to-SDF converter Given a (potentially nasty, nonconvex) mesh, automatically creates an SDF file that describes that object. The visual geometry i

Greg Izatt 22 Nov 23, 2022
Keval allows you to call arbitrary Windows kernel-mode functions from user mode, even (and primarily) on another machine.

Keval Keval allows you to call arbitrary Windows kernel-mode functions from user mode, even (and primarily) on another machine. The user mode portion

42 Dec 17, 2022
Tool for generating Memory.scan() compatible instruction search patterns

scanpat Tool for generating Frida Memory.scan() compatible instruction search patterns. Powered by r2. Examples $ ./scanpat.py arm.ks:64 'sub sp, sp,

Ole André Vadla Ravnås 13 Sep 19, 2022
Make some improvements in the Pizza class and pizzashop file by refactoring.

Make some improvements in the Pizza class and pizzashop file by refactoring.

James Brucker 1 Oct 18, 2021
Python humanize functions

humanize This modest package contains various common humanization utilities, like turning a number into a fuzzy human-readable duration ("3 minutes ag

Jason Moiron 1.6k Jan 01, 2023
Blender 2.93 addon for loading Quake II MD2 files

io_mesh_md2 is a Blender 2.93 addon for importing Quake II MD2 files.

Joshua Skelton 11 Aug 31, 2022
Parse URLs for DOIs, PubMed identifiers, PMC identifiers, arXiv identifiers, etc.

citation-url Parse URLs for DOIs, PubMed identifiers, PMC identifiers, arXiv identifiers, etc. This module has a single parse() function that takes in

Charles Tapley Hoyt 2 Feb 12, 2022
A simple API that will return a key-value pair of randomly generated UUID

A simple API that will return a key-value pair of randomly generated UUID. Key will be a timestamp and value will be UUID. While the server is running, whenever the API is called, it should return al

Pius Lucky 2 Jan 18, 2022
Simple tool for creating changelogs

Description Simple utility for quickly generating changelogs, assuming your commits are ordered as they should be. This tool will simply log all lates

2 Jan 05, 2022
PyResToolbox - A collection of Reservoir Engineering Utilities

pyrestoolbox A collection of Reservoir Engineering Utilities This set of functio

Mark W. Burgoyne 39 Oct 17, 2022
Local backup made easy, with Python and shutil

KTBackup BETA Local backup made easy, with Python and shutil Features One-command backup and restore Minimalistic (only using stdlib) Convenient direc

kelptaken 1 Dec 27, 2021
A simple tool to extract python code from a Jupyter notebook, and then run pylint on it for static analysis.

Jupyter Pylinter A simple tool to extract python code from a Jupyter notebook, and then run pylint on it for static analysis. If you find this tool us

Edmund Goodman 10 Oct 13, 2022
PyGMT - A Python interface for the Generic Mapping Tools

PyGMT A Python interface for the Generic Mapping Tools Documentation (development version) | Contact | Try Online Why PyGMT? A beautiful map is worth

The Generic Mapping Tools (GMT) 564 Dec 28, 2022
A string to hashtags module

A string to hashtags module

Fayas Noushad 4 Dec 01, 2021
Just some scripts to export vector tiles to geojson.

Vector tiles to GeoJSON Nowadays modern web maps are usually based on vector tiles. The great thing about vector tiles is, that they are not just imag

Lilith Wittmann 77 Jul 26, 2022
Create powerful passwords easily and with many options with this program

Password_Generator About the Program: You can create powerful passwords with this program with many options easily! Features: You can copy the generat

Sina.f 0 Jul 14, 2022
glip is a module for retrieve ip address like local-ip, global-ip, external-ip as string.

gle_ip_info glip is a module for retrieve ip address like local-ip, global-ip, external-ip as string.

Fatin Shadab 3 Nov 21, 2021
A python module for extract domains

A python module for extract domains

Fayas Noushad 4 Aug 10, 2022