Python codecs extension featuring CLI tools for encoding/decoding anything

Related tags

Command-line Toolspythonencodingcryptographydecoderdnamorsebase58codecbraillebase62ctfencodingsbaseleetspeakctf-toolsbase36encoder-decodercodecsbase100base45
Overview

CodExt Tweet

Encode/decode anything.

PyPi Read The Docs Build Status Coverage Status Python Versions Requirements Status Known Vulnerabilities DOI License

This library extends the native codecs library (namely for adding new custom encodings and character mappings) and provides a myriad of new encodings (static or parametrized, like rot or xor), hence its named combining CODecs EXTension.

$ pip install codext
Want to contribute a new codec ? Want to contribute a new macro ?
Check the documentation first
Then PR your new codec		 PR your updated version of macros.json

πŸ” Demonstrations

Using CodExt from the command line

Using base tools from the command line

Using the debase command line tool

πŸ’» Usage (main CLI tool) Tweet on codext

$ codext -i test.txt encode dna-1
GTGAGCGGGTATGTGA

$ echo -en "test" | codext encode morse
- . ... -

$ echo -en "test" | codext encode braille
β žβ ‘β Žβ ž

$ echo -en "test" | codext encode base100
πŸ‘«πŸ‘œπŸ‘ͺπŸ‘«

Chaining codecs

$ echo -en "Test string" | codext encode reverse
gnirts tseT

$ echo -en "Test string" | codext encode reverse morse
--. -. .. .-. - ... / - ... . -

$ echo -en "Test string" | codext encode reverse morse dna-2
AGTCAGTCAGTGAGAAAGTCAGTGAGAAAGTGAGTGAGAAAGTGAGTCAGTGAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTTAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTGAGAAAGTC

$ echo -en "Test string" | codext encode reverse morse dna-2 octal
101107124103101107124103101107124107101107101101101107124103101107124107101107101101101107124107101107124107101107101101101107124107101107124103101107124107101107101101101107124103101107101101101107124107101107124107101107124107101107101101101107124124101107101101101107124103101107101101101107124107101107124107101107124107101107101101101107124107101107101101101107124103

$ echo -en "AGTCAGTCAGTGAGAAAGTCAGTGAGAAAGTGAGTGAGAAAGTGAGTCAGTGAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTTAGAAAGTCAGAAAGTGAGTGAGTGAGAAAGTGAGAAAGTC" | codext -d dna-2 morse reverse
test string

Using macros

$ codext add-macro my-encoding-chain gzip base63 lzma base64

$ codext list macros
example-macro, my-encoding-chain

$ echo -en "Test string" | codext encode my-encoding-chain
CQQFAF0AAIAAABuTgySPa7WaZC5Sunt6FS0ko71BdrYE8zHqg91qaqadZIR2LafUzpeYDBalvE///ug4AA==

$ codext remove-macro my-encoding-chain

$ codext list macros
example-macro

πŸ’» Usage (base CLI tool) Tweet on debase

$ echo "Test string !" | base122
*.7!ft9οΏ½-f9Γ‚

$ echo "Test string !" | base91 
"ONK;WDZM%Z%xE7L

$ echo "Test string !" | base91 | base85
B2P|BJ6A+nO(j|-cttl%

$ echo "Test string !" | base91 | base85 | base36 | base58-flickr
QVx5tvgjvCAkXaMSuKoQmCnjeCV1YyyR3WErUUErFf

$ echo "Test string !" | base91 | base85 | base36 | base58-flickr | base58-flickr -d | base36 -d | base85 -d | base91 -d
Test string !

$ echo "Test string !" | base91 | base85 | base36 | base58-flickr | debase -m 3
Test string !

$ echo "Test string !" | base91 | base85 | base36 | base58-flickr | debase -f Test
Test string !

πŸ’» Usage (Python)

Getting the list of available codecs:

>> codext.encode("this is a test", "base58-ripple") 'jo9rA2LQwr44eBmZK7E' >>> codext.encode("this is a test", "base58-url") 'JN91Wzkpa1nnDbLyjtf' >>> codecs.encode("this is a test", "base100") 'πŸ‘«πŸ‘ŸπŸ‘ πŸ‘ͺπŸ—πŸ‘ πŸ‘ͺπŸ—πŸ‘˜πŸ—πŸ‘«πŸ‘œπŸ‘ͺπŸ‘«' >>> codecs.decode("πŸ‘«πŸ‘ŸπŸ‘ πŸ‘ͺπŸ—πŸ‘ πŸ‘ͺπŸ—πŸ‘˜πŸ—πŸ‘«πŸ‘œπŸ‘ͺπŸ‘«", "base100") 'this is a test' >>> for i in range(8): print(codext.encode("this is a test", "dna-%d" % (i + 1))) GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA CTCACGGACGGCCTATAGAACGGCCTATAGAACGACAGAACTCACGCCCTATCTCA ACAGATTGATTAACGCGTGGATTAACGCGTGGATGAGTGGACAGATAAACGCACAG AGACATTCATTAAGCGCTCCATTAAGCGCTCCATCACTCCAGACATAAAGCGAGAC TCTGTAAGTAATTCGCGAGGTAATTCGCGAGGTAGTGAGGTCTGTATTTCGCTCTG TGTCTAACTAATTGCGCACCTAATTGCGCACCTACTCACCTGTCTATTTGCGTGTC GAGTGCCTGCCGGATATCTTGCCGGATATCTTGCTGTCTTGAGTGCGGGATAGAGT CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT >>> codext.decode("GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA", "dna-1") 'this is a test' >>> codecs.encode("this is a test", "morse") '- .... .. ... / .. ... / .- / - . ... -' >>> codecs.decode("- .... .. ... / .. ... / .- / - . ... -", "morse") 'this is a test' >>> with open("morse.txt", 'w', encoding="morse") as f: f.write("this is a test") 14 >>> with open("morse.txt",encoding="morse") as f: f.read() 'this is a test' >>> codext.decode(""" = X : x n r y Y y p a ` n | a o h ` g o z """, "whitespace-after+before") 'CSC{not_so_invisible}' >>> print(codext.encode("An example test string", "baudot-tape")) ***.** . * ***.* * . .* * .* . * ** .* ***.** ** .** .* * . * *. * .* * *. * *. * * . * *. * *. * ***. *.* ***.* * .* "> 
>>> import codext

>>> codext.list()
['ascii85', 'base85', 'base100', 'base122', ..., 'tomtom', 'dna', 'html', 'markdown', 'url', 'resistor', 'sms', 'whitespace', 'whitespace-after-before']

>>> codext.encode("this is a test", "base58-bitcoin")
'jo91waLQA1NNeBmZKUF'

>>> codext.encode("this is a test", "base58-ripple")
'jo9rA2LQwr44eBmZK7E'

>>> codext.encode("this is a test", "base58-url")
'JN91Wzkpa1nnDbLyjtf'

>>> codecs.encode("this is a test", "base100")
'πŸ‘«πŸ‘ŸπŸ‘ πŸ‘ͺπŸ—πŸ‘ πŸ‘ͺπŸ—πŸ‘˜πŸ—πŸ‘«πŸ‘œπŸ‘ͺπŸ‘«'

>>> codecs.decode("πŸ‘«πŸ‘ŸπŸ‘ πŸ‘ͺπŸ—πŸ‘ πŸ‘ͺπŸ—πŸ‘˜πŸ—πŸ‘«πŸ‘œπŸ‘ͺπŸ‘«", "base100")
'this is a test'

>>> for i in range(8):
        print(codext.encode("this is a test", "dna-%d" % (i + 1)))
GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA
CTCACGGACGGCCTATAGAACGGCCTATAGAACGACAGAACTCACGCCCTATCTCA
ACAGATTGATTAACGCGTGGATTAACGCGTGGATGAGTGGACAGATAAACGCACAG
AGACATTCATTAAGCGCTCCATTAAGCGCTCCATCACTCCAGACATAAAGCGAGAC
TCTGTAAGTAATTCGCGAGGTAATTCGCGAGGTAGTGAGGTCTGTATTTCGCTCTG
TGTCTAACTAATTGCGCACCTAATTGCGCACCTACTCACCTGTCTATTTGCGTGTC
GAGTGCCTGCCGGATATCTTGCCGGATATCTTGCTGTCTTGAGTGCGGGATAGAGT
CACTCGGTCGGCCATATGTTCGGCCATATGTTCGTCTGTTCACTCGCCCATACACT
>>> codext.decode("GTGAGCCAGCCGGTATACAAGCCGGTATACAAGCAGACAAGTGAGCGGGTATGTGA", "dna-1")
'this is a test'

>>> codecs.encode("this is a test", "morse")
'- .... .. ... / .. ... / .- / - . ... -'

>>> codecs.decode("- .... .. ... / .. ... / .- / - . ... -", "morse")
'this is a test'

>>> with open("morse.txt", 'w', encoding="morse") as f:
	f.write("this is a test")
14

>>> with open("morse.txt",encoding="morse") as f:
	f.read()
'this is a test'

>>> codext.decode("""
      =            
              X         
   :            
      x         
  n  
    r 
        y   
      Y            
              y        
     p    
         a       
 `          
            n            
          |    
  a          
o    
       h        
          `            
          g               
           o 
   z      """, "whitespace-after+before")
'CSC{not_so_invisible}'

>>> print(codext.encode("An example test string", "baudot-tape"))
***.**
   . *
***.* 
*  .  
   .* 
*  .* 
   . *
** .* 
***.**
** .**
   .* 
*  .  
* *. *
   .* 
* *.  
* *. *
*  .  
* *.  
* *. *
***.  
  *.* 
***.* 
 * .*

πŸ“ƒ List of codecs

BaseXX

  • ascii85: classical ASCII85 (Python3 only)
  • baseN: see base encodings (incl base32, 36, 45, 58, 62, 63, 64, 91, 100, 122)
  • base-genericN: see base encodings ; supports any possible base

Binary

  • baudot: supports CCITT-1, CCITT-2, EU/FR, ITA1, ITA2, MTK-2 (Python3 only), UK, ...
  • baudot-spaced: variant of baudot ; groups of 5 bits are whitespace-separated
  • baudot-tape: variant of baudot ; outputs a string that looks like a perforated tape
  • bcd: Binary Coded Decimal, encodes characters from their (zero-left-padded) ordinals
  • bcd-extended0: variant of bcd ; encodes characters from their (zero-left-padded) ordinals using prefix bits 0000
  • bcd-extended1: variant of bcd ; encodes characters from their (zero-left-padded) ordinals using prefix bits 1111
  • excess3: uses Excess-3 (aka Stibitz code) binary encoding to convert characters from their ordinals
  • gray: aka reflected binary code
  • manchester: XORes each bit of the input with 01
  • manchester-inverted: variant of manchester ; XORes each bit of the input with 10
  • rotateN: rotates characters by the specified number of bits (N belongs to [1, 7] ; Python 3 only)

Common

  • a1z26: keeps words whitespace-separated and uses a custom character separator
  • cases: set of case-related encodings (including camel-, kebab-, lower-, pascal-, upper-, snake- and swap-case, slugify, capitalize, title)
  • dummy: set of simple encodings (including reverse and word-reverse)
  • octal: dummy octal conversion (converts to 3-digits groups)
  • octal-spaced: variant of octal ; dummy octal conversion, handling whitespace separators
  • ordinal: dummy character ordinals conversion (converts to 3-digits groups)
  • ordinal-spaced: variant of ordinal ; dummy character ordinals conversion, handling whitespace separators

Compression

  • gzip: standard Gzip compression/decompression
  • lz77: compresses the given data with the algorithm of Lempel and Ziv of 1977
  • lz78: compresses the given data with the algorithm of Lempel and Ziv of 1978
  • pkzip_deflate: standard Zip-deflate compression/decompression
  • pkzip_bzip2: standard BZip2 compression/decompression
  • pkzip_lzma: standard LZMA compression/decompression

Cryptography

  • affine: aka Affine Cipher
  • atbash: aka Atbash Cipher
  • bacon: aka Baconian Cipher
  • barbie-N: aka Barbie Typewriter (N belongs to [1, 4])
  • citrix: aka Citrix CTX1 passord encoding
  • rotN: aka Caesar cipher (N belongs to [1,25])
  • scytaleN: encrypts using the number of letters on the rod (N belongs to [1,[)
  • shiftN: shift ordinals (N belongs to [1,255])
  • xorN: XOR with a single byte (N belongs to [1,255])

Languages

  • braille: well-known braille language (Python 3 only)
  • ipsum: aka lorem ipsum
  • leetspeak: based on minimalistic elite speaking rules
  • morse: uses whitespace as a separator
  • navajo: only handles letters (not full words from the Navajo dictionary)
  • radio: aka NATO or radio phonetic alphabet
  • southpark: converts letters to Kenny's language from Southpark (whitespace is also handled)
  • southpark-icase: case insensitive variant of southpark
  • tomtom: similar to morse, using slashes and backslashes

Others

  • dna: implements the 8 rules of DNA sequences (N belongs to [1,8])
  • html: implements entities according to this reference
  • letter-indices: encodes consonants and/or vowels with their corresponding indices
  • markdown: unidirectional encoding from Markdown to HTML
  • url: aka URL encoding

Steganography

  • klopf: aka Klopf code ; Polybius square with trivial alphabetical distribution
  • resistor: aka resistor color codes
  • sms: also called T9 code ; uses "-" as a separator for encoding, "-" or "_" or whitespace for decoding
  • whitespace: replaces bits with whitespaces and tabs
  • whitespace_after_before: variant of whitespace ; encodes characters as new characters with whitespaces before and after according to an equation described in the codec name (e.g. "whitespace+2*after-3*before")

πŸ‘ Supporters

Stargazers repo roster for @dhondta/python-codext

Forkers repo roster for @dhondta/python-codext

Back to top

Comments
  • using Codext guess / Codext rank gives an error

    using Codext guess / Codext rank gives an error

    When I run it on linux and try to use "codext guess" or "codext rank" I get an error message saying:

    # echo "3yZe7d" | codext rank
Traceback (most recent call last):
  File "/usr/local/bin/codext", line 8, in <module>
    sys.exit(main())
  File "/usr/local/lib/python3.9/dist-packages/codext/__init__.py", line 184, in main
    args.include, args.exclude = __format_list(args.include), __format_list(args.exclude, False)
AttributeError: 'Namespace' object has no attribute 'include'
    opened by GitSunburn 1
  • UU decoding raises an exception in some cases

    UU decoding raises an exception in some cases 

    # cat raw.txt 
1Oh6axLwfecHErbVpRbtNj8t5JACsSQrofdnnMdQtBmoU8cQj6EyLcVRsQLz1MyWfXbqQDIc9wGyyBuH7uV95lBVpFGn3syGIw0IVLx8wJr4ABsIH9Q71hBH4AvIgljx7XnfjfmafahBNrPMDkK3dsJF0r41nzyMnOf7l36NcllAOgRLoB6Qh0APotZu6plYpkSiRCAkDKowOFm0mybKp336TAJe4JiDecD9hNbl5fBDLkGNYhmSkzOQzLBH1aPumW4o

# codext -i raw.txt decode base62
begin 666 <data>
M'XL( /H^)V("__-)SBB-<O7*+#;,K8PL\/ H\C#UR2LP= H)[email protected]\*"[email protected]
M\"T-\*@(#\]V\<A,*R^W\"@I,W9Q-,LU\8XR=$XM*TYR3PG,2G)+RO P#_'.
?"LRJS#)US0X(KPJH<[email protected](<TGR  #3A(K<90      
 
end

# codext -i raw.txt decode base62 | codext decode UU
Traceback (most recent call last):
  File "/usr/lib/python3.8/encodings/uu_codec.py", line 58, in uu_decode
    data = binascii.a2b_uu(s)
binascii.Error: Illegal char

During handling of the above exception, another exception occurred:

Traceback (most recent call last):
  File "/home/jeane/.local/bin/codext", line 8, in <module>
    sys.exit(main())
  File "/home/jeane/.local/lib/python3.8/site-packages/codext/__init__.py", line 124, in main
    c = getattr(codecs, ["encode", "decode"][args.command == "decode"])(c, encoding, args.errors)
  File "/home/jeane/.local/lib/python3.8/site-packages/codext/__common__.py", line 691, in decode
    return lookup(encoding).decode(obj, errors)[0]
  File "/usr/lib/python3.8/encodings/uu_codec.py", line 62, in uu_decode
    data = binascii.a2b_uu(s[:nbytes])
binascii.Error: Illegal char
    opened by RomainJennes 1
  • Implement Rail Fence Cipher

    Implement Rail Fence Cipher

    Tests pass.

    RegEx might need a fix : rail-5-3- is recognized as a valid codec (ending dash is too much). Only rail-5-3 or rail-5-3-up should be recognized. Couldn't manage to get that right.

    When encoding, there might be trailing whitespaces (which is normal), but users might forget one when copy/pasting. I left them invisible to ease the integration with other tools.

    opened by smarbal 0
  • Add tap/knock language

    Add tap/knock language

    Tap encoding and decoding is implemented and added to the documentation. Couldn't make it work with add_map() due to problems with letter and word separations (single space/double space). Did my own encoding/decoding functions instead.

    opened by smarbal 0
  • [Snyk] Security upgrade markdown2 from 2.3.10 to 2.4.0

    [Snyk] Security upgrade markdown2 from 2.3.10 to 2.4.0

    Snyk has created this PR to fix one or more vulnerable packages in the `pip` dependencies of this project.

    Changes included in this PR

    • Changes to the following files to upgrade the vulnerable dependencies to a fixed version:
      • requirements.txt

    Vulnerabilities that will be fixed

    By pinning:

    Severity | Priority Score (*) | Issue | Upgrade | Breaking Change | Exploit Maturity :-------------------------:|-------------------------|:-------------------------|:-------------------------|:-------------------------|:------------------------- high severity | 768/1000
    Why? Proof of Concept exploit, Recently disclosed, Has a fix available, CVSS 7.5 | Regular Expression Denial of Service (ReDoS)
    SNYK-PYTHON-MARKDOWN2-1063233 | markdown2:
    2.3.10 -> 2.4.0
    | No | Proof of Concept

    (*) Note that the real score may have changed since the PR was raised.

    Some vulnerabilities couldn't be fully fixed and so Snyk will still find them when the project is tested again. This may be because the vulnerability existed within more than one direct dependency, but not all of the effected dependencies could be upgraded.

    Check the changes in this PR to ensure they won't cause issues with your project.

    Note: You are seeing this because you or someone else with access to this repository has authorized Snyk to open fix PRs.

    For more information: 🧐 View latest project report

    πŸ›  Adjust project settings

    πŸ“š Read more about Snyk's upgrade and patch logic

    opened by dhondta 0
  • pip 22.3 / python 3.10 warning on install

    pip 22.3 / python 3.10 warning on install

    Looks like there's a warning on the installation method via pip:

    pip install codext         
Collecting codext
  Downloading codext-1.14.0.tar.gz (116 kB)
     ━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━━ 116.2/116.2 kB 1.7 MB/s eta 0:00:00
  Preparing metadata (setup.py) ... done
Requirement already satisfied: six in ./venv/lib/python3.10/site-packages (from codext) (1.16.0)
Collecting markdown2>=2.4.0
  Downloading markdown2-2.4.6-py2.py3-none-any.whl (37 kB)
Installing collected packages: markdown2, codext
  DEPRECATION: codext is being installed using the legacy 'setup.py install' method, because it does not have a 'pyproject.toml' and the 'wheel' package is not installed. pip 23.1 will enforce this behaviour change. A possible replacement is to enable the '--use-pep517' option. Discussion can be found at https://github.com/pypa/pip/issues/8559
  Running setup.py install for codext ... done
Successfully installed codext-1.14.0 markdown2-2.4.6
    opened by mikeatlas 0
Releases(1.10.1)
Owner
Alex
I'm a security professional, passionate about programming (especially Python) and cyber security.
Alex
GitHub Repository
Dark powered asynchronous completion framework for neovim/Vim8

deoplete.nvim Dark powered asynchronous completion framework for neovim/Vim8 Note: The development of this plugin is finished. Accepts minor patches a

Shougo 5.9k Dec 30, 2022
🌈 Lightweight Python package that makes it easy and fast to print terminal messages in colors. 🌈

🌈 Colorist for Python 🌈 Lightweight Python package that makes it easy and fast to print terminal messages in colors. Prerequisites Python 3.9 or hig

Jakob Bagterp 1 Feb 05, 2022
Helicopter animation in terminal

helicopter-helicopter Helicopter animation in terminal (scroll down for instructions) Why does this exist? It's because of a meme Click for details Se

Wasi Master 7 Mar 14, 2022
(BionicLambda Universal SHell) A simple shell made in Python. Docs and possible C port incoming.

blush 😳 (BionicLambda Universal SHell) A simple shell made in Python. Docs and possible C port incoming. Note: The Linux executables were made on Ubu

3 Jun 30, 2021
Pequeno joguinho pra vocΓͺ rodar no seu terminal

JokenPython Pequeno joguinho pra vocΓͺ rodar no seu terminal OlΓ‘! Joguinho legal pra vc rodar no seu terminal!! (rode no terminal, pra melhor experienc

Scott 4 Nov 25, 2021
A command line application to analyse reports from TBC Warcraft Logs.

README A command line application to analyse reports from TBC Warcraft Logs. The application was written and tested with Python 3.9. Features Dumps an

2 Dec 17, 2021
Hack-All is a simple CLI tool that helps ethical-hackers to make a reverse connection without knowing the target device in use is it computer or phone

Hack-All is a simple CLI tool that helps ethical-hackers to make a reverse connection without knowing the target device in use is it computer

LightYagami17 5 Nov 22, 2022
CLI client for RFC 4226's HOTP and RFC 6238's TOTP.

One Time Password (OTP, TOTP/HOTP) OTP serves as additional protection in case of password leaks. onetimepass allows you to manage OTP codes and gener

Apptension 4 Jan 05, 2022
A command line tool to hide and reveal information inside images (works for both PNGs and JPGs)

Imgrerite A command line tool to hide and reveal information inside images (works for both PNGs and JPGs) Dependencies Python 3 Git Most of the Linux

Jigyasu 10 Jul 27, 2022
Task-manager-CLI with Priority Modification

Task-manager-CLI with Priority Modification The functions for the app have been written in task.py file. 1. Install Node.js This project requires Node

1 Jan 21, 2022
As easy as /aitch-tee-tee-pie/ πŸ₯§ Modern, user-friendly command-line HTTP client for the API era. JSON support, colors, sessions, downloads, plugins & more. https://twitter.com/httpie

HTTPie: human-friendly CLI HTTP client for the API era HTTPie (pronounced aitch-tee-tee-pie) is a command-line HTTP client. Its goal is to make CLI in

HTTPie 25.4k Dec 30, 2022
Dynamically Generate GitHub Stats as like Terminal Interface

GitHub Stats Terminal Style Dynamically Generate GitHub Stats as like Terminal Interface Usage Create a New Repository using this Template or click he

YOGESHWARAN R 63 Jan 03, 2023
A startpage configured aesthetically with terminal-esque link formatting

Terminal-y Startpage Setup Clone the repository, then make an unformatted.txt file following the specifications in example.txt. Run format.py Open ind

belkarx 13 May 01, 2022
A linux-like remote terminal for Micropython

A linux-like remote terminal for Micropython

Christian KΓΆver - Draxl 2 Nov 14, 2021
Very nice SMS & Mail Bomber for Termux and Linux.

Very nice SMS & Mail Bomber for Termux and Linux. Coded with love)))

nordbearbot.dev 5 Nov 06, 2022
AML Command Transfer. A lightweight tool to transfer any command line to Azure Machine Learning Services

AML Command Transfer (ACT) ACT is a lightweight tool to transfer any command from the local machine to AML or ITP, both of which are Azure Machine Lea

Microsoft 11 Aug 10, 2022
Simple Python Library to display text with color in Python Terminal

pyTextColor v1.0 Introduction pyTextColor is a simple Python Library to display colorful outputs in Terminal, etc. Note: Your Terminal or any software

Siddhesh Chavan 1 Jan 23, 2022
A simple CLI productivity tool to quickly display the syntax of a desired piece of code

Iforgor Iforgor is a customisable and easy to use command line tool to manage code samples. It's a good way to quickly get your hand on syntax you don

Solaris 21 Jan 03, 2023
Wordle breaker: A CLI tool to help you solve Wordle

Wordle Breaker A CLI tool to help you solve Wordle I decided to code a solution

Alex 4 Apr 27, 2022
CLI utility to search and download torrents from major torrent sites

CLI Torrent Downloader About CLI Torrent Downloader provides convenient and quick way to search torrent magnet links (and to run associated torrent cl

x0r0x 86 Dec 19, 2022