Extract longest transcript or longest CDS transcript from GTF annotation file or gencode transcripts fasta file.

Related tags

File & Path UtilitiesGetTransTool
Overview

GetTransTool Package

There are four types of methods to extract longest transcript or longest CDS regeion with longest transcript from transcripts fasta file or GTF file.

  • 1.Extract longest transcript from gencode transcripts fasta file.

  • 2.Extract longest transcript from gtf format annotation file based on gencode/ensembl/ucsc database.

  • 3.Extract longest CDS regeion with longest transcript from gencode database transcripts fasta file.

  • 4.Extract longest CDS regeion with longest transcript from gtf format annotation file based on ensembl/ucsc database.

Install

$ pip install GetTransTool

Usage

1. get longest transcript from gencode transcripts fasta file:

help infomation:

$ GetLongestTransFromGencode -h
usage: GetLongestTransFromGencode --file gencode.vM28.transcripts.fa.gz --outfile longest_trans.fa

Get longest transcripts from gencode transcripts fasta file.

optional arguments:
  -h, --help            show this help message and exit
  -v, --version         show program's version number and exit
  -f transfile, --file transfile
                        input your transcripts file with ".gz" format. (gencode.vM28.transcripts.fa.gz)
  -o longestfile, --outfile longestfile
                        output your longest transcript file. (longest_trans.fa)

Thank your for your support, if you have any questions or suggestions please contact me: [email protected].

usage:

$ GetLongestTransFromGencode --file gencode.vM28.transcripts.fa.gz --outfile longest_trans_gencode.fa
Your job is running, please wait...
Your job is done!
Running with 32.33 seconds!

there will be three files produced including name_changed.fa, longest_transcripts_info.csv, longest_trans_gencode.fa.

name_changed.fa:

>4933401J01Rik_ENSMUSG00000102693.2_ENSMUST00000193812.2_1070
AAGGAAAGAGGATAACACTTGAAATGTAAATAAAGAAAATACCTAATAAAAATAAATAAA
AACATGCTTTCAAAGGAAATAAAAAGTTGGATTCAAAAATTTAACTTTTGCTCATTTGGT
ATAATCAAGGAAAAGACCTTTGCATATAAAATATATTTTGAATAAAATTCAGTGGAAGAA
...

longest_transcripts_info.csv:

this is the longest transcripts exon length information.

fullname,gene_name,translength
snoZ196_ENSMUSG00002074855.1_ENSMUST00020182568.1_35,snoZ196,35
snoZ159_ENSMUSG00002075734.1_ENSMUST00020182611.1_87,snoZ159,87
n-R5s93_ENSMUSG00000119639.1_ENSMUST00000240071.1_119,n-R5s93,119
...

longest_trans_gencode.fa:

this is the filtered longest transcript fasta file.

>4933401J01Rik_ENSMUSG00000102693.2_ENSMUST00000193812.2_1070
AAGGAAAGAGGATAACACTTGAAATGTAAATAAAGAAAATACCTAATAAAAATAAATAAA
AACATGCTTTCAAAGGAAATAAAAAGTTGGATTCAAAAATTTAACTTTTGCTCATTTGGT
ATAATCAAGGAAAAGACCTTTGCATATAAAATATATTTTGAATAAAATTCAGTGGAAGAA
...

2. Extract longest transcript from gtf format annotation file based on gencode/ensembl/ucsc database:

help infomation:

$ GetLongestTransFromGTF -h
usage: GetLongestTransFromGTF --database ensembl --gtffile Homo_sapiens.GRCh38.101.gtf.gz --genome Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz --outfile longest_trans.fa

Extract longest transcript from gtf format annotation file based on gencode/ensembl/ucsc database.

optional arguments:
  -h, --help            show this help message and exit
  -v, --version         show program's version number and exit
  -d databse, --database databse
                        which annotation database you choose. (default="ensembl", ucsc/ensembl/gencode)
  -g gtffile, --gtffile gtffile
                        input your GTF file with ".gz" format.
  -fa genome, --genome genome
                        your genome fasta file matched with your GTF file with ".gz" format. (Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz)
  -o longestfile, --outfile longestfile
                        output your longest transcript file. (longest_trans.fa)

Thank your for your support, if you have any questions or suggestions please contact me: [email protected].

usage:

$ GetLongestTransFromGTF --database ensembl --gtffile Homo_sapiens.GRCh38.103.gtf.gz --genome Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz --outfile longest_trans_ensembl.fa
Your job is running, please wait...
Your job is done! 
Running with 159.51 seconds!

there will be three files produced including longest_transcripts_info.csv, longest_trans.gtf, longest_trans_ensembl.fa.

longest_transcripts_info.csv:

,transcript_length,gene_name
snoZ196_ENSG00000281780_ENST00000625269_snoRNA,89,snoZ196
hsa-mir-423_ENSG00000266919_ENST00000586878_lncRNA,94,hsa-mir-423
hsa-mir-1253_ENSG00000272920_ENST00000609567_lncRNA,105,hsa-mir-1253
...

longest_trans.gtf:

this is the gtf information for the longest transcripts.

1	havana	gene	11869	14409	.	+	.	gene_id "ENSG00000223972"; gene_version "5"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene";
1	havana	transcript	11869	14409	.	+	.	gene_id "ENSG00000223972"; gene_version "5"; transcript_id "ENST00000456328"; transcript_version "2"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; tag "basic"; transcript_support_level "1";
1	havana	exon	11869	12227	.	+	.	gene_id "ENSG00000223972"; gene_version "5"; transcript_id "ENST00000456328"; transcript_version "2"; exon_number "1"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; exon_id "ENSE00002234944"; exon_version "1"; tag "basic"; transcript_support_level "1";
1	havana	exon	12613	12721	.	+	.	gene_id "ENSG00000223972"; gene_version "5"; transcript_id "ENST00000456328"; transcript_version "2"; exon_number "2"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; exon_id "ENSE00003582793"; exon_version "1"; tag "basic"; transcript_support_level "1";
1	havana	exon	13221	14409	.	+	.	gene_id "ENSG00000223972"; gene_version "5"; transcript_id "ENST00000456328"; transcript_version "2"; exon_number "3"; gene_name "DDX11L1"; gene_source "havana"; gene_biotype "transcribed_unprocessed_pseudogene"; transcript_name "DDX11L1-202"; transcript_source "havana"; transcript_biotype "processed_transcript"; exon_id "ENSE00002312635"; exon_version "1"; tag "basic"; transcript_support_level "1";
1	havana	gene	14404	29570	.	-	.	gene_id "ENSG00000227232"; gene_version "5"; gene_name "WASH7P"; gene_source "havana"; gene_biotype "unprocessed_pseudogene";

longest_trans_ensembl.fa:

>DDX11L1_ENSG00000223972_ENST00000456328_transcribed_unprocessed_pseudogene
GTTAACTTGCCGTCAGCCTTTTCTTTGACCTCTTCTTTCTGTTCATGTGTATTTGCTGTC
TCTTAGCCCAGACTTCCCGTGTCCTTTCCACCGGGCCTTTGAGAGGTCACAGGGTCTTGA
TGCTGTGGTCTTCATCTGCAGGTGTCTGACTTCCAGCAACTGCTGGCCTGTGCCAGGGTG
...

for ucsc:

$ GetLongestTransFromGTF --database ucsc --gtffile hg19.ncbiRefSeq.gtf.gz --genome hg19.fa.gz --outfile longest_trans_ucsc.fa

3. Extract longest CDS regeion with longest transcript from gencode database transcripts fasta file.

help infomation:

$ GetCDSLongestFromGencode -h
usage: GetCDSLongestFromGencode --file gencode.vM28.pc_transcripts.fa.gz --outfile longest_cds_trans.fa

Extract longest CDS regeion with longest transcript from gencode database transcripts fasta file.

optional arguments:
  -h, --help            show this help message and exit
  -v, --version         show program's version number and exit
  -f transfile, --file transfile
                        input your protein-coding transcripts file with ".gz" format. (gencode.vM28.pc_transcripts.fa.gz)
  -o longestfile, --outfile longestfile
                        output your longest transcript file. (longest_cds_trans.fa)

Thank your for your support, if you have any questions or suggestions please contact me: [email protected].

usage:

$ GetCDSLongestFromGencode --file gencode.vM28.pc_transcripts.fa.gz --outfile longest_cds_trans_gencode.fa
Your job is running, please wait...
Your job is done! 
Running with 17.67 seconds!

there will be four files produced including name_changed.fa, All_transcripts_cds_info.csv, longest_cds_transcripts_info.csv, longest_cds_trans_gencode.fa.

name_changed.fa:

>Xkr4_ENSMUSG00000051951.6_ENSMUST00000070533.5_151_2094_3634
GCGGCGGCGGGCGAGCGGGCGCTGGAGTAGGAGCTGGGGAGCGGCGCGGCCGGGGAAGGA
AGCCAGGGCGAGGCGAGGAGGTGGCGGGAGGAGGAGACAGCAGGGACAGGTGTCAGATAA
AGGAGTGCTCTCCTCCGCTGCCGAGGCATCATGGCCGCTAAGTCAGACGGGAGGCTGAAG
...

All_transcripts_cds_info.csv:

this is the all transcripts cds and exon length information.

fullname,gene_name,translength,cdslength
>mt-Nd6_ENSMUSG00000064368.1_ENSMUST00000082419.1_1_519_519,>mt-Nd6,519,519
>mt-Nd5_ENSMUSG00000064367.1_ENSMUST00000082418.1_1_1824_1824,>mt-Nd5,1824,1824
>mt-Nd4l_ENSMUSG00000065947.1_ENSMUST00000084013.1_1_297_297,>mt-Nd4l,297,297
...

longest_cds_transcripts_info.csv:

fullname,gene_name,translength,cdslength
>mt-Nd6_ENSMUSG00000064368.1_ENSMUST00000082419.1_1_519_519,>mt-Nd6,519,519
>mt-Nd5_ENSMUSG00000064367.1_ENSMUST00000082418.1_1_1824_1824,>mt-Nd5,1824,1824
>mt-Nd4l_ENSMUSG00000065947.1_ENSMUST00000084013.1_1_297_297,>mt-Nd4l,297,297
...

longest_cds_trans_gencode.fa:

>Xkr4_ENSMUSG00000051951.6_ENSMUST00000070533.5_151_2094_3634
GCGGCGGCGGGCGAGCGGGCGCTGGAGTAGGAGCTGGGGAGCGGCGCGGCCGGGGAAGGA
AGCCAGGGCGAGGCGAGGAGGTGGCGGGAGGAGGAGACAGCAGGGACAGGTGTCAGATAA
AGGAGTGCTCTCCTCCGCTGCCGAGGCATCATGGCCGCTAAGTCAGACGGGAGGCTGAAG
...

4. Extract longest CDS regeion with longest transcript from gtf format annotation file based on ensembl/ucsc database.

help infomation:

$ GetCDSLongestFromGTF -h
usage: GetCDSLongestFromGTF --database ensembl --gtffile Homo_sapiens.GRCh38.101.gtf.gz --genome Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz --outfile longest_cds_trans.fa

Extract longest CDS regeion with longest transcript from gtf format annotation file based on ensembl/ucsc database.

optional arguments:
  -h, --help            show this help message and exit
  -v, --version         show program's version number and exit
  -d databse, --database databse
                        which annotation database you choose. (default="ensembl", ucsc/ensembl)
  -g gtffile, --gtffile gtffile
                        input your GTF file with ".gz" format.
  -fa genome, --genome genome
                        your genome fasta file matched with your GTF file with ".gz" format. (Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz)
  -o cdslongestfile, --outfile cdslongestfile
                        output your longest transcript file. (longest_cds_trans.fa)

Thank your for your support, if you have any questions or suggestions please contact me: [email protected].

usage:

$ GetCDSLongestFromGTF  --database ensembl --gtffile Homo_sapiens.GRCh38.103.gtf.gz --genome Homo_sapiens.GRCh38.dna.primary_assembly.fa.gz --outfile longest_cds_trans_ensembl.fa
Your job is running, please wait...
Your job is done! 
Running with 152.38 seconds!

there will be four files produced including CDS_longest_trans.gtf, All_transcripts_cds_info.csv, longest_cds_transcripts_info.csv, longest_cds_trans_ensembl.fa.

CDS_longest_trans.gtf:

1	ensembl_havana	gene	65419	71585	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding";
1	havana	transcript	65419	71585	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	havana	exon	65419	65433	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "1"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; exon_id "ENSE00003812156"; exon_version "1"; tag "basic";
1	havana	exon	65520	65573	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; exon_id "ENSE00003813641"; exon_version "1"; tag "basic";
1	havana	CDS	65565	65573	.	+	0	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; protein_id "ENSP00000493376"; protein_version "2"; tag "basic";
1	havana	start_codon	65565	65567	.	+	0	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	havana	exon	69037	71585	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "3"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; exon_id "ENSE00003813949"; exon_version "1"; tag "basic";
1	havana	CDS	69037	70005	.	+	0	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "3"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; protein_id "ENSP00000493376"; protein_version "2"; tag "basic";
1	havana	stop_codon	70006	70008	.	+	0	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; exon_number "3"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	havana	five_prime_utr	65419	65433	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	havana	five_prime_utr	65520	65564	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	havana	three_prime_utr	70009	71585	.	+	.	gene_id "ENSG00000186092"; gene_version "6"; transcript_id "ENST00000641515"; transcript_version "2"; gene_name "OR4F5"; gene_source "ensembl_havana"; gene_biotype "protein_coding"; transcript_name "OR4F5-202"; transcript_source "havana"; transcript_biotype "protein_coding"; tag "basic";
1	ensembl_havana	gene	450740	451678	.	-	.	gene_id "ENSG00000284733"; gene_version "2"; gene_name "OR4F29"; gene_source "ensembl_havana"; gene_biotype "protein_coding";
...

All_transcripts_cds_info.csv:

this is the all transcripts cds and exon length information.

cdslength,ID,translength,utr5length,gene_name
2709,ZZZ3_ENSG00000036549_ENST00000370801,6412,476,ZZZ3
1227,ZZZ3_ENSG00000036549_ENST00000370798,2468,486,ZZZ3
173,ZZZ3_ENSG00000036549_ENST00000433749,603,430,ZZZ3
...

longest_cds_transcripts_info.csv:

cdslength,ID,translength,utr5length,gene_name
2709,ZZZ3_ENSG00000036549_ENST00000370801,6412,476,ZZZ3
8883,ZZEF1_ENSG00000074755_ENST00000381638,11466,135,ZZEF1
1716,ZYX_ENSG00000159840_ENST00000322764,2228,80,ZYX
...

longest_cds_trans_gencode.fa:

>OR4F5_ENSG00000186092_ENST00000641515_61_1038_2618
CCCAGATCTCTTCAGTTTTTATGCCTCATTCTGTGAAAATTGCTGTAGTCTCTTCCAGTT
ATGAAGAAGGTAACTGCAGAGGCTATTTCCTGGAATGAATCAACGAGTGAAACGAATAAC
TCTATGGTGACTGAATTCATTTTTCTGGGTCTCTCTGATTCTCAGGAACTCCAGACCTTC
...

for ucsc:

$ GetCDSLongestFromGTF  --database ucsc --gtffile hg19.ncbiRefSeq.gtf.gz --genome hg19.fa.gz --outfile longest_cds_trans_ensembl.fa

END

Thank your for your support, if you have any questions or suggestions please contact me: [email protected].

Owner
laojunjun
路漫漫其修远兮 吾将上下而求索
laojunjun
GitHub Repository
Object-oriented file system path manipulation

path (aka path pie, formerly path.py) implements path objects as first-class entities, allowing common operations on files to be invoked on those path

Jason R. Coombs 1k Dec 28, 2022
Instant Fuzzy File Search for Alfred

List all the files inside a folder using fd, and instantly fuzzy-search through all of them using fzf, all from inside Alfred with a single keyword: fzf.

Mr. Pennyworth 37 Nov 30, 2022
Find potentially sensitive files

find_files Find potentially sensitive files This script searchs for potentially sensitive files based off of file name or string contained in the file

4 Aug 20, 2022
Organizer is a python program that organizes your downloads folder

Organizer Organizer is a python program that organizes your downloads folder, it can run as a service and so will start along with the system, and the

Gustavo 2 Oct 18, 2021
csv2ir is a script to convert ir .csv files to .ir files for the flipper.

csv2ir csv2ir is a script to convert ir .csv files to .ir files for the flipper. For a repo of .ir files, please see https://github.com/logickworkshop

Alex 38 Dec 31, 2022
Import Python modules from any file system path

pathimp Import Python modules from any file system path. Installation pip3 install pathimp Usage import pathimp

Danijar Hafner 2 Nov 29, 2021
CSV To VCF (Multiples en un archivo)

CSV To VCF Convierte archivo CSV a Tarjeta VCF (varias en una) How to use En main.py debes reemplazar CONTACTOS.csv por tu archivo csv, y debes respet

Jorge Ivaldi 2 Jan 12, 2022
Publicly Open Amazon AWS S3 Bucket Viewer

S3Viewer Publicly open storage viewer (Amazon S3 Bucket, Azure Blob, FTP server, HTTP Index Of/) s3viewer is a free tool for security researchers that

Sharon Brizinov 377 Dec 02, 2022
Search for files under the specified directory. Extract the file name and file path and import them as data.

Search for files under the specified directory. Extract the file name and file path and import them as data. Based on that, search for the file, select it and open it.

G-jon FujiYama 2 Jan 10, 2022
A python wrapper for libmagic

python-magic python-magic is a Python interface to the libmagic file type identification library. libmagic identifies file types by checking their hea

Adam Hupp 2.3k Dec 29, 2022
Extract longest transcript or longest CDS transcript from GTF annotation file or gencode transcripts fasta file.

Extract longest transcript or longest CDS transcript from GTF annotation file or gencode transcripts fasta file.

laojunjun 13 Nov 23, 2022
Simple archive format designed for quickly reading some files without extracting the entire archive

Simple archive format designed for quickly reading some files without extracting the entire archive

Jarred Sumner 336 Dec 30, 2022
A python script generate password files in plain text

KeePass (or any desktop pw manager?) Helper WARNING: This script will generate password files in plain text. ITS NOT SECURE. I needed help remembering

Eric Thomas 1 Nov 21, 2021
File-manager - A basic file manager, written in Python

File Manager A basic file manager, written in Python. Installation Install Pytho

Samuel Ko 1 Feb 05, 2022
LightCSV - This CSV reader is implemented in just pure Python.

LightCSV Simple light CSV reader This CSV reader is implemented in just pure Python. It allows to specify a separator, a quote char and column titles

Jose Rodriguez 6 Mar 05, 2022
Convert All TXT Files To One File.

AllToOne Convert All TXT Files To One File. Hi 👋 , I'm Alireza A Python Developer Boy 🔭 I’m currently working on my C# projects 🌱 I’m currently Lea

4 Jun 07, 2022
Dragon Age: Origins toolset to extract/build .erf files, patch language-specific .dlg files, and view the contents of files in the ERF or GFF format

DAOTools This is a set of tools for Dragon Age: Origins modding. It can patch the text lines of .dlg files, extract and build an .erf file, and view t

8 Dec 06, 2022
Generates a clean .txt file of contents of a 3 lined csv file

Generates a clean .txt file of contents of a 3 lined csv file. File contents is the .gml file of some function which stores the contents of the csv as a map.

Alex Eckardt 1 Jan 09, 2022
Read and write TIFF files

Read and write TIFF files Tifffile is a Python library to store numpy arrays in TIFF (Tagged Image File Format) files, and read image and metadata fro

Christoph Gohlke 346 Dec 18, 2022
Python script for converting figma produced SVG files into C++ JUCE framework source code

AutoJucer Python script for converting figma produced SVG files into C++ JUCE framework source code Watch the tutorial here! Getting Started Make some

SuperConductor 1 Nov 26, 2021